ID: 1001174854

View in Genome Browser
Species Human (GRCh38)
Location 5:169458740-169458762
Sequence CTGTAGTTTTTCAGGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001174839_1001174854 29 Left 1001174839 5:169458688-169458710 CCAAGTCCTTTAGCCCTTATCGC No data
Right 1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG No data
1001174849_1001174854 -9 Left 1001174849 5:169458726-169458748 CCAAATTTTGATCTCTGTAGTTT No data
Right 1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG No data
1001174845_1001174854 15 Left 1001174845 5:169458702-169458724 CCTTATCGCCAGGGAACTGAGGG No data
Right 1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG No data
1001174843_1001174854 16 Left 1001174843 5:169458701-169458723 CCCTTATCGCCAGGGAACTGAGG No data
Right 1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG No data
1001174842_1001174854 23 Left 1001174842 5:169458694-169458716 CCTTTAGCCCTTATCGCCAGGGA No data
Right 1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG No data
1001174848_1001174854 7 Left 1001174848 5:169458710-169458732 CCAGGGAACTGAGGGGCCAAATT No data
Right 1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001174854 Original CRISPR CTGTAGTTTTTCAGGGGACA GGG Intergenic
No off target data available for this crispr