ID: 1001178597

View in Genome Browser
Species Human (GRCh38)
Location 5:169496824-169496846
Sequence CACTTTGTTTGGGTGGCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001178593_1001178597 2 Left 1001178593 5:169496799-169496821 CCTGAGGCAAGGATTAAAATGCT No data
Right 1001178597 5:169496824-169496846 CACTTTGTTTGGGTGGCATAAGG No data
1001178592_1001178597 3 Left 1001178592 5:169496798-169496820 CCCTGAGGCAAGGATTAAAATGC No data
Right 1001178597 5:169496824-169496846 CACTTTGTTTGGGTGGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001178597 Original CRISPR CACTTTGTTTGGGTGGCATA AGG Intergenic
No off target data available for this crispr