ID: 1001178926

View in Genome Browser
Species Human (GRCh38)
Location 5:169500198-169500220
Sequence GTCCTAAGCAGGCTAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001178926_1001178931 20 Left 1001178926 5:169500198-169500220 CCTTCCTTTAGCCTGCTTAGGAC No data
Right 1001178931 5:169500241-169500263 CTGACCCACAGCCTTTTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001178926 Original CRISPR GTCCTAAGCAGGCTAAAGGA AGG (reversed) Intergenic
No off target data available for this crispr