ID: 1001179939

View in Genome Browser
Species Human (GRCh38)
Location 5:169510893-169510915
Sequence TTGTCACAGCTGAGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001179939_1001179946 22 Left 1001179939 5:169510893-169510915 CCCCTCTGCCTCAGCTGTGACAA No data
Right 1001179946 5:169510938-169510960 ATTCCCATTGTTTTCTGAGTTGG No data
1001179939_1001179944 -9 Left 1001179939 5:169510893-169510915 CCCCTCTGCCTCAGCTGTGACAA No data
Right 1001179944 5:169510907-169510929 CTGTGACAAGCACCAGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001179939 Original CRISPR TTGTCACAGCTGAGGCAGAG GGG (reversed) Intergenic
No off target data available for this crispr