ID: 1001180135

View in Genome Browser
Species Human (GRCh38)
Location 5:169512692-169512714
Sequence TACCTGGTGATTGGTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001180135_1001180143 21 Left 1001180135 5:169512692-169512714 CCTGTCCCACCAATCACCAGGTA No data
Right 1001180143 5:169512736-169512758 ATAACTGTCTGGCTAAATATCGG No data
1001180135_1001180140 10 Left 1001180135 5:169512692-169512714 CCTGTCCCACCAATCACCAGGTA No data
Right 1001180140 5:169512725-169512747 CAGCCTTCCAGATAACTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001180135 Original CRISPR TACCTGGTGATTGGTGGGAC AGG (reversed) Intergenic
No off target data available for this crispr