ID: 1001181632

View in Genome Browser
Species Human (GRCh38)
Location 5:169526058-169526080
Sequence ACTAGACAGTGCCCCAGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001181627_1001181632 -5 Left 1001181627 5:169526040-169526062 CCCTCTTCTCACAGCTCCACTAG 0: 1665
1: 2050
2: 1368
3: 825
4: 701
Right 1001181632 5:169526058-169526080 ACTAGACAGTGCCCCAGTAGGGG No data
1001181625_1001181632 21 Left 1001181625 5:169526014-169526036 CCATTCTGGAGTCTGAAGGACAG No data
Right 1001181632 5:169526058-169526080 ACTAGACAGTGCCCCAGTAGGGG No data
1001181628_1001181632 -6 Left 1001181628 5:169526041-169526063 CCTCTTCTCACAGCTCCACTAGA 0: 103
1: 1764
2: 2044
3: 1393
4: 1006
Right 1001181632 5:169526058-169526080 ACTAGACAGTGCCCCAGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001181632 Original CRISPR ACTAGACAGTGCCCCAGTAG GGG Intergenic
No off target data available for this crispr