ID: 1001181640

View in Genome Browser
Species Human (GRCh38)
Location 5:169526081-169526103
Sequence GGGGTCGGATCCCCCACATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001181640_1001181653 21 Left 1001181640 5:169526081-169526103 CCCTATGTGGGGGATCCGACCCC No data
Right 1001181653 5:169526125-169526147 CTAGCACAGGTTCTCCATGAGGG 0: 16
1: 1111
2: 1516
3: 1250
4: 912
1001181640_1001181648 8 Left 1001181640 5:169526081-169526103 CCCTATGTGGGGGATCCGACCCC No data
Right 1001181648 5:169526112-169526134 CTTCCACATTGCCCTAGCACAGG No data
1001181640_1001181652 20 Left 1001181640 5:169526081-169526103 CCCTATGTGGGGGATCCGACCCC No data
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001181640 Original CRISPR GGGGTCGGATCCCCCACATA GGG (reversed) Intergenic
No off target data available for this crispr