ID: 1001181641 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:169526082-169526104 |
Sequence | TGGGGTCGGATCCCCCACAT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1001181641_1001181648 | 7 | Left | 1001181641 | 5:169526082-169526104 | CCTATGTGGGGGATCCGACCCCA | No data | ||
Right | 1001181648 | 5:169526112-169526134 | CTTCCACATTGCCCTAGCACAGG | No data | ||||
1001181641_1001181653 | 20 | Left | 1001181641 | 5:169526082-169526104 | CCTATGTGGGGGATCCGACCCCA | No data | ||
Right | 1001181653 | 5:169526125-169526147 | CTAGCACAGGTTCTCCATGAGGG | 0: 16 1: 1111 2: 1516 3: 1250 4: 912 |
||||
1001181641_1001181652 | 19 | Left | 1001181641 | 5:169526082-169526104 | CCTATGTGGGGGATCCGACCCCA | No data | ||
Right | 1001181652 | 5:169526124-169526146 | CCTAGCACAGGTTCTCCATGAGG | 0: 20 1: 1107 2: 1623 3: 1385 4: 1078 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1001181641 | Original CRISPR | TGGGGTCGGATCCCCCACAT AGG (reversed) | Intergenic | ||
No off target data available for this crispr |