ID: 1001181642

View in Genome Browser
Species Human (GRCh38)
Location 5:169526096-169526118
Sequence GTGGAAGGGAAATGTGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4316
Summary {0: 229, 1: 457, 2: 903, 3: 1206, 4: 1521}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001181642_1001181653 6 Left 1001181642 5:169526096-169526118 CCGACCCCACATTTCCCTTCCAC 0: 229
1: 457
2: 903
3: 1206
4: 1521
Right 1001181653 5:169526125-169526147 CTAGCACAGGTTCTCCATGAGGG 0: 16
1: 1111
2: 1516
3: 1250
4: 912
1001181642_1001181648 -7 Left 1001181642 5:169526096-169526118 CCGACCCCACATTTCCCTTCCAC 0: 229
1: 457
2: 903
3: 1206
4: 1521
Right 1001181648 5:169526112-169526134 CTTCCACATTGCCCTAGCACAGG No data
1001181642_1001181652 5 Left 1001181642 5:169526096-169526118 CCGACCCCACATTTCCCTTCCAC 0: 229
1: 457
2: 903
3: 1206
4: 1521
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001181642 Original CRISPR GTGGAAGGGAAATGTGGGGT CGG (reversed) Intergenic
Too many off-targets to display for this crispr