ID: 1001181643 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:169526100-169526122 |
| Sequence | CAATGTGGAAGGGAAATGTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4526 | |||
| Summary | {0: 37, 1: 472, 2: 797, 3: 1422, 4: 1798} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1001181643_1001181652 | 1 | Left | 1001181643 | 5:169526100-169526122 | CCCCACATTTCCCTTCCACATTG | 0: 37 1: 472 2: 797 3: 1422 4: 1798 |
||
| Right | 1001181652 | 5:169526124-169526146 | CCTAGCACAGGTTCTCCATGAGG | 0: 20 1: 1107 2: 1623 3: 1385 4: 1078 |
||||
| 1001181643_1001181653 | 2 | Left | 1001181643 | 5:169526100-169526122 | CCCCACATTTCCCTTCCACATTG | 0: 37 1: 472 2: 797 3: 1422 4: 1798 |
||
| Right | 1001181653 | 5:169526125-169526147 | CTAGCACAGGTTCTCCATGAGGG | 0: 16 1: 1111 2: 1516 3: 1250 4: 912 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1001181643 | Original CRISPR | CAATGTGGAAGGGAAATGTG GGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||