ID: 1001181643

View in Genome Browser
Species Human (GRCh38)
Location 5:169526100-169526122
Sequence CAATGTGGAAGGGAAATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4526
Summary {0: 37, 1: 472, 2: 797, 3: 1422, 4: 1798}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001181643_1001181652 1 Left 1001181643 5:169526100-169526122 CCCCACATTTCCCTTCCACATTG 0: 37
1: 472
2: 797
3: 1422
4: 1798
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078
1001181643_1001181653 2 Left 1001181643 5:169526100-169526122 CCCCACATTTCCCTTCCACATTG 0: 37
1: 472
2: 797
3: 1422
4: 1798
Right 1001181653 5:169526125-169526147 CTAGCACAGGTTCTCCATGAGGG 0: 16
1: 1111
2: 1516
3: 1250
4: 912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001181643 Original CRISPR CAATGTGGAAGGGAAATGTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr