ID: 1001181644

View in Genome Browser
Species Human (GRCh38)
Location 5:169526101-169526123
Sequence GCAATGTGGAAGGGAAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4965
Summary {0: 35, 1: 497, 2: 807, 3: 1549, 4: 2077}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001181644_1001181653 1 Left 1001181644 5:169526101-169526123 CCCACATTTCCCTTCCACATTGC 0: 35
1: 497
2: 807
3: 1549
4: 2077
Right 1001181653 5:169526125-169526147 CTAGCACAGGTTCTCCATGAGGG 0: 16
1: 1111
2: 1516
3: 1250
4: 912
1001181644_1001181652 0 Left 1001181644 5:169526101-169526123 CCCACATTTCCCTTCCACATTGC 0: 35
1: 497
2: 807
3: 1549
4: 2077
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078
1001181644_1001181657 30 Left 1001181644 5:169526101-169526123 CCCACATTTCCCTTCCACATTGC 0: 35
1: 497
2: 807
3: 1549
4: 2077
Right 1001181657 5:169526154-169526176 CCCTGTAGCAAACTTTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001181644 Original CRISPR GCAATGTGGAAGGGAAATGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr