ID: 1001181644 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:169526101-169526123 |
| Sequence | GCAATGTGGAAGGGAAATGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4965 | |||
| Summary | {0: 35, 1: 497, 2: 807, 3: 1549, 4: 2077} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1001181644_1001181653 | 1 | Left | 1001181644 | 5:169526101-169526123 | CCCACATTTCCCTTCCACATTGC | 0: 35 1: 497 2: 807 3: 1549 4: 2077 |
||
| Right | 1001181653 | 5:169526125-169526147 | CTAGCACAGGTTCTCCATGAGGG | 0: 16 1: 1111 2: 1516 3: 1250 4: 912 |
||||
| 1001181644_1001181652 | 0 | Left | 1001181644 | 5:169526101-169526123 | CCCACATTTCCCTTCCACATTGC | 0: 35 1: 497 2: 807 3: 1549 4: 2077 |
||
| Right | 1001181652 | 5:169526124-169526146 | CCTAGCACAGGTTCTCCATGAGG | 0: 20 1: 1107 2: 1623 3: 1385 4: 1078 |
||||
| 1001181644_1001181657 | 30 | Left | 1001181644 | 5:169526101-169526123 | CCCACATTTCCCTTCCACATTGC | 0: 35 1: 497 2: 807 3: 1549 4: 2077 |
||
| Right | 1001181657 | 5:169526154-169526176 | CCCTGTAGCAAACTTTTGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1001181644 | Original CRISPR | GCAATGTGGAAGGGAAATGT GGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||