ID: 1001181645

View in Genome Browser
Species Human (GRCh38)
Location 5:169526102-169526124
Sequence GGCAATGTGGAAGGGAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5020
Summary {0: 37, 1: 477, 2: 848, 3: 1564, 4: 2094}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001181645_1001181659 30 Left 1001181645 5:169526102-169526124 CCACATTTCCCTTCCACATTGCC 0: 37
1: 477
2: 848
3: 1564
4: 2094
Right 1001181659 5:169526155-169526177 CCTGTAGCAAACTTTTGACTGGG No data
1001181645_1001181652 -1 Left 1001181645 5:169526102-169526124 CCACATTTCCCTTCCACATTGCC 0: 37
1: 477
2: 848
3: 1564
4: 2094
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078
1001181645_1001181653 0 Left 1001181645 5:169526102-169526124 CCACATTTCCCTTCCACATTGCC 0: 37
1: 477
2: 848
3: 1564
4: 2094
Right 1001181653 5:169526125-169526147 CTAGCACAGGTTCTCCATGAGGG 0: 16
1: 1111
2: 1516
3: 1250
4: 912
1001181645_1001181657 29 Left 1001181645 5:169526102-169526124 CCACATTTCCCTTCCACATTGCC 0: 37
1: 477
2: 848
3: 1564
4: 2094
Right 1001181657 5:169526154-169526176 CCCTGTAGCAAACTTTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001181645 Original CRISPR GGCAATGTGGAAGGGAAATG TGG (reversed) Intergenic
Too many off-targets to display for this crispr