ID: 1001181647

View in Genome Browser
Species Human (GRCh38)
Location 5:169526111-169526133
Sequence CTGTGCTAGGGCAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001181647_1001181652 -10 Left 1001181647 5:169526111-169526133 CCTTCCACATTGCCCTAGCACAG No data
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078
1001181647_1001181660 29 Left 1001181647 5:169526111-169526133 CCTTCCACATTGCCCTAGCACAG No data
Right 1001181660 5:169526163-169526185 AAACTTTTGACTGGGCATCTAGG No data
1001181647_1001181659 21 Left 1001181647 5:169526111-169526133 CCTTCCACATTGCCCTAGCACAG No data
Right 1001181659 5:169526155-169526177 CCTGTAGCAAACTTTTGACTGGG No data
1001181647_1001181653 -9 Left 1001181647 5:169526111-169526133 CCTTCCACATTGCCCTAGCACAG No data
Right 1001181653 5:169526125-169526147 CTAGCACAGGTTCTCCATGAGGG 0: 16
1: 1111
2: 1516
3: 1250
4: 912
1001181647_1001181657 20 Left 1001181647 5:169526111-169526133 CCTTCCACATTGCCCTAGCACAG No data
Right 1001181657 5:169526154-169526176 CCCTGTAGCAAACTTTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001181647 Original CRISPR CTGTGCTAGGGCAATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr