ID: 1001181648

View in Genome Browser
Species Human (GRCh38)
Location 5:169526112-169526134
Sequence CTTCCACATTGCCCTAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001181641_1001181648 7 Left 1001181641 5:169526082-169526104 CCTATGTGGGGGATCCGACCCCA No data
Right 1001181648 5:169526112-169526134 CTTCCACATTGCCCTAGCACAGG No data
1001181636_1001181648 19 Left 1001181636 5:169526070-169526092 CCCAGTAGGGGCCCTATGTGGGG No data
Right 1001181648 5:169526112-169526134 CTTCCACATTGCCCTAGCACAGG No data
1001181642_1001181648 -7 Left 1001181642 5:169526096-169526118 CCGACCCCACATTTCCCTTCCAC 0: 229
1: 457
2: 903
3: 1206
4: 1521
Right 1001181648 5:169526112-169526134 CTTCCACATTGCCCTAGCACAGG No data
1001181634_1001181648 20 Left 1001181634 5:169526069-169526091 CCCCAGTAGGGGCCCTATGTGGG No data
Right 1001181648 5:169526112-169526134 CTTCCACATTGCCCTAGCACAGG No data
1001181638_1001181648 18 Left 1001181638 5:169526071-169526093 CCAGTAGGGGCCCTATGTGGGGG No data
Right 1001181648 5:169526112-169526134 CTTCCACATTGCCCTAGCACAGG No data
1001181640_1001181648 8 Left 1001181640 5:169526081-169526103 CCCTATGTGGGGGATCCGACCCC No data
Right 1001181648 5:169526112-169526134 CTTCCACATTGCCCTAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001181648 Original CRISPR CTTCCACATTGCCCTAGCAC AGG Intergenic
No off target data available for this crispr