ID: 1001181652

View in Genome Browser
Species Human (GRCh38)
Location 5:169526124-169526146
Sequence CCTAGCACAGGTTCTCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5213
Summary {0: 20, 1: 1107, 2: 1623, 3: 1385, 4: 1078}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001181642_1001181652 5 Left 1001181642 5:169526096-169526118 CCGACCCCACATTTCCCTTCCAC 0: 229
1: 457
2: 903
3: 1206
4: 1521
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078
1001181643_1001181652 1 Left 1001181643 5:169526100-169526122 CCCCACATTTCCCTTCCACATTG 0: 37
1: 472
2: 797
3: 1422
4: 1798
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078
1001181641_1001181652 19 Left 1001181641 5:169526082-169526104 CCTATGTGGGGGATCCGACCCCA No data
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078
1001181645_1001181652 -1 Left 1001181645 5:169526102-169526124 CCACATTTCCCTTCCACATTGCC 0: 37
1: 477
2: 848
3: 1564
4: 2094
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078
1001181646_1001181652 -9 Left 1001181646 5:169526110-169526132 CCCTTCCACATTGCCCTAGCACA No data
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078
1001181640_1001181652 20 Left 1001181640 5:169526081-169526103 CCCTATGTGGGGGATCCGACCCC No data
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078
1001181644_1001181652 0 Left 1001181644 5:169526101-169526123 CCCACATTTCCCTTCCACATTGC 0: 35
1: 497
2: 807
3: 1549
4: 2077
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078
1001181638_1001181652 30 Left 1001181638 5:169526071-169526093 CCAGTAGGGGCCCTATGTGGGGG No data
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078
1001181647_1001181652 -10 Left 1001181647 5:169526111-169526133 CCTTCCACATTGCCCTAGCACAG No data
Right 1001181652 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG 0: 20
1: 1107
2: 1623
3: 1385
4: 1078

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001181652 Original CRISPR CCTAGCACAGGTTCTCCATG AGG Intergenic
Too many off-targets to display for this crispr