ID: 1001181657

View in Genome Browser
Species Human (GRCh38)
Location 5:169526154-169526176
Sequence CCCTGTAGCAAACTTTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001181649_1001181657 16 Left 1001181649 5:169526115-169526137 CCACATTGCCCTAGCACAGGTTC No data
Right 1001181657 5:169526154-169526176 CCCTGTAGCAAACTTTTGACTGG No data
1001181647_1001181657 20 Left 1001181647 5:169526111-169526133 CCTTCCACATTGCCCTAGCACAG No data
Right 1001181657 5:169526154-169526176 CCCTGTAGCAAACTTTTGACTGG No data
1001181644_1001181657 30 Left 1001181644 5:169526101-169526123 CCCACATTTCCCTTCCACATTGC 0: 35
1: 497
2: 807
3: 1549
4: 2077
Right 1001181657 5:169526154-169526176 CCCTGTAGCAAACTTTTGACTGG No data
1001181650_1001181657 8 Left 1001181650 5:169526123-169526145 CCCTAGCACAGGTTCTCCATGAG No data
Right 1001181657 5:169526154-169526176 CCCTGTAGCAAACTTTTGACTGG No data
1001181645_1001181657 29 Left 1001181645 5:169526102-169526124 CCACATTTCCCTTCCACATTGCC 0: 37
1: 477
2: 848
3: 1564
4: 2094
Right 1001181657 5:169526154-169526176 CCCTGTAGCAAACTTTTGACTGG No data
1001181646_1001181657 21 Left 1001181646 5:169526110-169526132 CCCTTCCACATTGCCCTAGCACA No data
Right 1001181657 5:169526154-169526176 CCCTGTAGCAAACTTTTGACTGG No data
1001181654_1001181657 -8 Left 1001181654 5:169526139-169526161 CCATGAGGGCACTGCCCCTGTAG No data
Right 1001181657 5:169526154-169526176 CCCTGTAGCAAACTTTTGACTGG No data
1001181651_1001181657 7 Left 1001181651 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG No data
Right 1001181657 5:169526154-169526176 CCCTGTAGCAAACTTTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001181657 Original CRISPR CCCTGTAGCAAACTTTTGAC TGG Intergenic
No off target data available for this crispr