ID: 1001181659

View in Genome Browser
Species Human (GRCh38)
Location 5:169526155-169526177
Sequence CCTGTAGCAAACTTTTGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001181651_1001181659 8 Left 1001181651 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG No data
Right 1001181659 5:169526155-169526177 CCTGTAGCAAACTTTTGACTGGG No data
1001181647_1001181659 21 Left 1001181647 5:169526111-169526133 CCTTCCACATTGCCCTAGCACAG No data
Right 1001181659 5:169526155-169526177 CCTGTAGCAAACTTTTGACTGGG No data
1001181645_1001181659 30 Left 1001181645 5:169526102-169526124 CCACATTTCCCTTCCACATTGCC 0: 37
1: 477
2: 848
3: 1564
4: 2094
Right 1001181659 5:169526155-169526177 CCTGTAGCAAACTTTTGACTGGG No data
1001181646_1001181659 22 Left 1001181646 5:169526110-169526132 CCCTTCCACATTGCCCTAGCACA No data
Right 1001181659 5:169526155-169526177 CCTGTAGCAAACTTTTGACTGGG No data
1001181649_1001181659 17 Left 1001181649 5:169526115-169526137 CCACATTGCCCTAGCACAGGTTC No data
Right 1001181659 5:169526155-169526177 CCTGTAGCAAACTTTTGACTGGG No data
1001181654_1001181659 -7 Left 1001181654 5:169526139-169526161 CCATGAGGGCACTGCCCCTGTAG No data
Right 1001181659 5:169526155-169526177 CCTGTAGCAAACTTTTGACTGGG No data
1001181650_1001181659 9 Left 1001181650 5:169526123-169526145 CCCTAGCACAGGTTCTCCATGAG No data
Right 1001181659 5:169526155-169526177 CCTGTAGCAAACTTTTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001181659 Original CRISPR CCTGTAGCAAACTTTTGACT GGG Intergenic
No off target data available for this crispr