ID: 1001181660

View in Genome Browser
Species Human (GRCh38)
Location 5:169526163-169526185
Sequence AAACTTTTGACTGGGCATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001181646_1001181660 30 Left 1001181646 5:169526110-169526132 CCCTTCCACATTGCCCTAGCACA No data
Right 1001181660 5:169526163-169526185 AAACTTTTGACTGGGCATCTAGG No data
1001181649_1001181660 25 Left 1001181649 5:169526115-169526137 CCACATTGCCCTAGCACAGGTTC No data
Right 1001181660 5:169526163-169526185 AAACTTTTGACTGGGCATCTAGG No data
1001181647_1001181660 29 Left 1001181647 5:169526111-169526133 CCTTCCACATTGCCCTAGCACAG No data
Right 1001181660 5:169526163-169526185 AAACTTTTGACTGGGCATCTAGG No data
1001181654_1001181660 1 Left 1001181654 5:169526139-169526161 CCATGAGGGCACTGCCCCTGTAG No data
Right 1001181660 5:169526163-169526185 AAACTTTTGACTGGGCATCTAGG No data
1001181650_1001181660 17 Left 1001181650 5:169526123-169526145 CCCTAGCACAGGTTCTCCATGAG No data
Right 1001181660 5:169526163-169526185 AAACTTTTGACTGGGCATCTAGG No data
1001181651_1001181660 16 Left 1001181651 5:169526124-169526146 CCTAGCACAGGTTCTCCATGAGG No data
Right 1001181660 5:169526163-169526185 AAACTTTTGACTGGGCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001181660 Original CRISPR AAACTTTTGACTGGGCATCT AGG Intergenic
No off target data available for this crispr