ID: 1001182253

View in Genome Browser
Species Human (GRCh38)
Location 5:169531305-169531327
Sequence ACCTAAGGGGGATCTCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001182241_1001182253 -3 Left 1001182241 5:169531285-169531307 CCCCAATTCCCATTGATATGACC No data
Right 1001182253 5:169531305-169531327 ACCTAAGGGGGATCTCTTGGGGG No data
1001182235_1001182253 26 Left 1001182235 5:169531256-169531278 CCTCTCCCCACCTGGAGTGTTGG No data
Right 1001182253 5:169531305-169531327 ACCTAAGGGGGATCTCTTGGGGG No data
1001182240_1001182253 16 Left 1001182240 5:169531266-169531288 CCTGGAGTGTTGGTGTGTGCCCC No data
Right 1001182253 5:169531305-169531327 ACCTAAGGGGGATCTCTTGGGGG No data
1001182242_1001182253 -4 Left 1001182242 5:169531286-169531308 CCCAATTCCCATTGATATGACCT No data
Right 1001182253 5:169531305-169531327 ACCTAAGGGGGATCTCTTGGGGG No data
1001182239_1001182253 19 Left 1001182239 5:169531263-169531285 CCACCTGGAGTGTTGGTGTGTGC No data
Right 1001182253 5:169531305-169531327 ACCTAAGGGGGATCTCTTGGGGG No data
1001182238_1001182253 20 Left 1001182238 5:169531262-169531284 CCCACCTGGAGTGTTGGTGTGTG No data
Right 1001182253 5:169531305-169531327 ACCTAAGGGGGATCTCTTGGGGG No data
1001182237_1001182253 21 Left 1001182237 5:169531261-169531283 CCCCACCTGGAGTGTTGGTGTGT No data
Right 1001182253 5:169531305-169531327 ACCTAAGGGGGATCTCTTGGGGG No data
1001182243_1001182253 -5 Left 1001182243 5:169531287-169531309 CCAATTCCCATTGATATGACCTA No data
Right 1001182253 5:169531305-169531327 ACCTAAGGGGGATCTCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001182253 Original CRISPR ACCTAAGGGGGATCTCTTGG GGG Intergenic
No off target data available for this crispr