ID: 1001184079

View in Genome Browser
Species Human (GRCh38)
Location 5:169550643-169550665
Sequence AACCCCCTTGTCTCATGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001184074_1001184079 7 Left 1001184074 5:169550613-169550635 CCCCCTTCGGGTGAGAAGACTTG No data
Right 1001184079 5:169550643-169550665 AACCCCCTTGTCTCATGAGCAGG No data
1001184075_1001184079 6 Left 1001184075 5:169550614-169550636 CCCCTTCGGGTGAGAAGACTTGT No data
Right 1001184079 5:169550643-169550665 AACCCCCTTGTCTCATGAGCAGG No data
1001184076_1001184079 5 Left 1001184076 5:169550615-169550637 CCCTTCGGGTGAGAAGACTTGTC No data
Right 1001184079 5:169550643-169550665 AACCCCCTTGTCTCATGAGCAGG No data
1001184077_1001184079 4 Left 1001184077 5:169550616-169550638 CCTTCGGGTGAGAAGACTTGTCC No data
Right 1001184079 5:169550643-169550665 AACCCCCTTGTCTCATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001184079 Original CRISPR AACCCCCTTGTCTCATGAGC AGG Intergenic
No off target data available for this crispr