ID: 1001185413

View in Genome Browser
Species Human (GRCh38)
Location 5:169567001-169567023
Sequence CAGGAATAGGTGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001185413_1001185421 -3 Left 1001185413 5:169567001-169567023 CCTTCCACCTTCACCTATTCCTG No data
Right 1001185421 5:169567021-169567043 CTGGAGACCTCTGGCCCTATGGG No data
1001185413_1001185427 23 Left 1001185413 5:169567001-169567023 CCTTCCACCTTCACCTATTCCTG No data
Right 1001185427 5:169567047-169567069 TTAGCAAGGTATAGACTCAGTGG No data
1001185413_1001185424 9 Left 1001185413 5:169567001-169567023 CCTTCCACCTTCACCTATTCCTG No data
Right 1001185424 5:169567033-169567055 GGCCCTATGGGGTATTAGCAAGG No data
1001185413_1001185422 -2 Left 1001185413 5:169567001-169567023 CCTTCCACCTTCACCTATTCCTG No data
Right 1001185422 5:169567022-169567044 TGGAGACCTCTGGCCCTATGGGG No data
1001185413_1001185420 -4 Left 1001185413 5:169567001-169567023 CCTTCCACCTTCACCTATTCCTG No data
Right 1001185420 5:169567020-169567042 CCTGGAGACCTCTGGCCCTATGG No data
1001185413_1001185428 30 Left 1001185413 5:169567001-169567023 CCTTCCACCTTCACCTATTCCTG No data
Right 1001185428 5:169567054-169567076 GGTATAGACTCAGTGGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001185413 Original CRISPR CAGGAATAGGTGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr