ID: 1001186041

View in Genome Browser
Species Human (GRCh38)
Location 5:169573870-169573892
Sequence TTTTATAGGAACAAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001186041_1001186045 -6 Left 1001186041 5:169573870-169573892 CCCTCCTTCTTGTTCCTATAAAA No data
Right 1001186045 5:169573887-169573909 ATAAAAACATCTGTGCAAAGTGG No data
1001186041_1001186046 -5 Left 1001186041 5:169573870-169573892 CCCTCCTTCTTGTTCCTATAAAA No data
Right 1001186046 5:169573888-169573910 TAAAAACATCTGTGCAAAGTGGG No data
1001186041_1001186047 4 Left 1001186041 5:169573870-169573892 CCCTCCTTCTTGTTCCTATAAAA No data
Right 1001186047 5:169573897-169573919 CTGTGCAAAGTGGGCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001186041 Original CRISPR TTTTATAGGAACAAGAAGGA GGG (reversed) Intergenic
No off target data available for this crispr