ID: 1001186300

View in Genome Browser
Species Human (GRCh38)
Location 5:169576361-169576383
Sequence TGGGCTTTACCCCAGCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001186292_1001186300 28 Left 1001186292 5:169576310-169576332 CCAAAGCCAATAGATATGACTTT No data
Right 1001186300 5:169576361-169576383 TGGGCTTTACCCCAGCTGCTTGG No data
1001186296_1001186300 5 Left 1001186296 5:169576333-169576355 CCAAAGAAGCATGCTTTGTGGGA No data
Right 1001186300 5:169576361-169576383 TGGGCTTTACCCCAGCTGCTTGG No data
1001186293_1001186300 22 Left 1001186293 5:169576316-169576338 CCAATAGATATGACTTTCCAAAG No data
Right 1001186300 5:169576361-169576383 TGGGCTTTACCCCAGCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001186300 Original CRISPR TGGGCTTTACCCCAGCTGCT TGG Intergenic
No off target data available for this crispr