ID: 1001192964

View in Genome Browser
Species Human (GRCh38)
Location 5:169647592-169647614
Sequence CAAGCTCACCAGTTCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001192959_1001192964 11 Left 1001192959 5:169647558-169647580 CCAAACAGTGGACTCCTGCAGAT 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1001192964 5:169647592-169647614 CAAGCTCACCAGTTCTCCCTGGG 0: 1
1: 0
2: 3
3: 13
4: 163
1001192961_1001192964 -3 Left 1001192961 5:169647572-169647594 CCTGCAGATGGTCACTCTACCAA 0: 1
1: 0
2: 0
3: 13
4: 70
Right 1001192964 5:169647592-169647614 CAAGCTCACCAGTTCTCCCTGGG 0: 1
1: 0
2: 3
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001192964 Original CRISPR CAAGCTCACCAGTTCTCCCT GGG Intronic
900055571 1:627582-627604 AAATCTCAGCAGTTCTGCCTGGG + Intergenic
901051691 1:6428705-6428727 CAAGGTCACCTGTTCCCCTTGGG + Intronic
902102605 1:14004590-14004612 GAACATCACCAGTACTCCCTAGG - Intergenic
902482632 1:16719656-16719678 CAAGGTCACCTGTTCCCCTTGGG - Intergenic
902510769 1:16965879-16965901 CAGGCTTACCCGTTCTCTCTGGG - Exonic
903069698 1:20721014-20721036 CAGGCTCACCCCTTCCCCCTAGG - Intronic
904129944 1:28268176-28268198 CAACCTCGCCAGTTGTCCCCCGG - Intronic
905431669 1:37929008-37929030 CAAGCTCTCCAGTTCTGTTTGGG - Intronic
906528103 1:46508204-46508226 CATGGGCACCTGTTCTCCCTAGG - Intronic
907500075 1:54872561-54872583 TACGCTCACCAATTCCCCCTTGG + Intronic
909818076 1:80022226-80022248 TCAGCTTACCAGTTCTCCATAGG - Intergenic
911160672 1:94679903-94679925 CAAACTCAGCTGGTCTCCCTGGG - Intergenic
912384827 1:109266027-109266049 CAGGCTCCCCAGCCCTCCCTAGG - Intronic
912451991 1:109773037-109773059 CAAGCTCACCAGCTCCTTCTGGG - Intronic
914858335 1:151368071-151368093 CCAGCTCACTGGTTCTCCTTGGG + Intronic
914975560 1:152357666-152357688 TAGGCTGACCAGGTCTCCCTTGG - Intronic
915972992 1:160367121-160367143 CAAGCCCACCACTTCCACCTGGG + Exonic
916175428 1:162034087-162034109 CAAGCTCTCCATTTCTTCCCAGG + Intergenic
917667421 1:177238666-177238688 CAATCTCCCCAATTCTCCCATGG + Intronic
918653328 1:186993334-186993356 CATGCTCAAGAGTTTTCCCTGGG + Intergenic
919819137 1:201462004-201462026 CAAGCCCATCCCTTCTCCCTCGG + Intergenic
920186069 1:204160247-204160269 CAAGTTCACCAGCTCTGACTGGG - Intronic
921447732 1:215266249-215266271 TAATCTCAGCAATTCTCCCTGGG + Intergenic
1063090650 10:2863573-2863595 CAACCTCACCATCTCTCCATGGG + Intergenic
1064071214 10:12229576-12229598 CCAGCTAATCAGTTCTTCCTTGG + Intronic
1065530504 10:26665304-26665326 CAATCTTAGCACTTCTCCCTGGG + Intergenic
1068187622 10:53606201-53606223 TAGGCTCAACATTTCTCCCTTGG - Intergenic
1072744968 10:97933453-97933475 CATGCCCACCTGTTCTTCCTGGG + Intronic
1073858126 10:107701435-107701457 CCAGATCACCAGGTCTCTCTTGG + Intergenic
1074934408 10:118163526-118163548 GAAGCTCCCCATTCCTCCCTAGG + Intergenic
1075753240 10:124791348-124791370 CAGGCCCAGCACTTCTCCCTCGG + Intronic
1076506871 10:130984162-130984184 CAAGCTCACCAGCACACCATGGG - Intergenic
1077279410 11:1735339-1735361 CAACATCACCAGTTCTGCCCTGG - Exonic
1077721706 11:4636902-4636924 CAAGCCCACCCTTTCTTCCTTGG - Intergenic
1079170885 11:18094444-18094466 CACGCTCTACAGTTGTCCCTTGG - Intronic
1081232687 11:40605586-40605608 CCAGCTCTCAAATTCTCCCTGGG + Intronic
1083892660 11:65604331-65604353 CAGGCTCTCAAGTTCTCCTTTGG + Intronic
1084102520 11:66958805-66958827 CAAGCACAACAGTTCGCACTGGG + Intergenic
1084358047 11:68652421-68652443 CCTGCTCACCAGTGCCCCCTGGG + Intergenic
1085736971 11:79047434-79047456 CAAGCTCACTCGTGCTCTCTGGG + Intronic
1087223471 11:95571509-95571531 AAATCTCACCATTTCTTCCTAGG - Intergenic
1087491280 11:98830153-98830175 CAAGCTTTGCAGTCCTCCCTGGG - Intergenic
1088287288 11:108201828-108201850 CAAGCTCCCCAGCTTTCTCTGGG - Intronic
1088654375 11:111985308-111985330 GGAGCTCACCAGTTGTTCCTCGG - Intronic
1089706017 11:120278403-120278425 CAAGGTCACTCGTTCTCACTGGG - Intronic
1092205002 12:6609225-6609247 AGTGCTCAGCAGTTCTCCCTTGG - Intergenic
1092222580 12:6724973-6724995 CAAGCAAACCAGCTCTCCTTTGG + Intronic
1093750014 12:22787605-22787627 CAAGTTCCCCAGTGATCCCTAGG - Intergenic
1094486685 12:30930815-30930837 CAAGCACTCCCTTTCTCCCTGGG + Intronic
1103932264 12:124457097-124457119 CCAGCTCACCAGCTCCACCTGGG + Exonic
1105937442 13:25115272-25115294 CCATCTCACCATTTCCCCCTTGG - Intergenic
1108847397 13:54694371-54694393 CAAGCTCCCCAGCTTTCGCTGGG + Intergenic
1110711981 13:78659881-78659903 TAACCTCACAAATTCTCCCTTGG - Intergenic
1111507025 13:89204799-89204821 TAAGCTCACAAATTCTCACTTGG - Intergenic
1112916085 13:104552149-104552171 CAAGTTCACCAGTTTTCTGTGGG + Intergenic
1115855192 14:37622804-37622826 CCAGCTCTCCTGTTCTCCCTGGG - Intronic
1117400621 14:55355701-55355723 CAAGCTCCACAGTGGTCCCTCGG - Intronic
1118337753 14:64868445-64868467 CAAGCTCACCATGTCATCCTGGG - Intronic
1119982168 14:79094020-79094042 CAAGCTCTCCTGTCCTCACTTGG + Intronic
1121091995 14:91189351-91189373 CCAGCTCACCATTTCCACCTGGG - Intronic
1123472095 15:20562862-20562884 CACCCTCACCAGTCATCCCTGGG + Intergenic
1123645908 15:22437491-22437513 CACCCTCACCAGTCATCCCTGGG - Intergenic
1123732399 15:23157853-23157875 CACCCTCACCAGTCATCCCTGGG + Intergenic
1123750534 15:23355235-23355257 CACCCTCACCAGTCATCCCTGGG + Intronic
1124203675 15:27699334-27699356 CAAGCTTCCCTGTTCTCTCTAGG + Intergenic
1124282903 15:28379151-28379173 CACCCTCACCAGTCATCCCTGGG + Intronic
1124299796 15:28532462-28532484 CACCCTCACCAGTCATCCCTGGG - Intronic
1129838317 15:78727603-78727625 CACCCTCACCAGTCATCCCTGGG + Intronic
1130601946 15:85281671-85281693 CAAGCTCACTCCTTCTCACTGGG + Intergenic
1133587359 16:7208862-7208884 AAAGCCCACCAGTTCTCCTAAGG + Intronic
1137306688 16:47207593-47207615 CAAGCTCATCCCCTCTCCCTGGG - Intronic
1138596049 16:58029514-58029536 CAATCAGACCAGTTCTCTCTGGG - Intronic
1139773725 16:69299761-69299783 CACTCTTACCAGTTCTCCCTCGG - Exonic
1141188482 16:81806521-81806543 CAAGCTGAGCAGTGCTGCCTGGG - Intronic
1143520194 17:7440309-7440331 CAATCTCCCCAGCTCTCCCTCGG + Intronic
1144397645 17:14860712-14860734 CAAGCTAAGCATTTCTCACTAGG + Intergenic
1148093837 17:45038981-45039003 CTAGCTCTCCAGTTTTCCCAAGG - Intronic
1148247048 17:46039281-46039303 CAAGCTCTCGAGTTCTCTCTAGG + Intronic
1151727234 17:75892192-75892214 CAGGCTTACTTGTTCTCCCTGGG - Intronic
1151935073 17:77256536-77256558 AAAGCTCCCCACTTCTGCCTGGG - Intergenic
1152637725 17:81436989-81437011 CAAGCTCCACAGATTTCCCTGGG + Intronic
1152824522 17:82456205-82456227 CAAGCTGTCCAGTTGTTCCTGGG + Intergenic
1156773376 18:40757622-40757644 CTAACTCCCCAGTGCTCCCTGGG - Intergenic
1156949924 18:42883180-42883202 CTAGCACACCAGGTCTGCCTGGG - Intronic
1158407243 18:57171017-57171039 CCAGGTCACCACTTCTCACTGGG - Intergenic
1159358708 18:67371347-67371369 AACGCTCACCAGTTGTCCTTTGG - Intergenic
1160171854 18:76561915-76561937 CAAGGCCTCCAGTTATCCCTGGG - Intergenic
1166213287 19:41320773-41320795 CAAGCCCCCCAAGTCTCCCTAGG + Intronic
1168497680 19:56867668-56867690 GATGCTAACCAGTTCTCCATAGG - Intergenic
927208181 2:20623130-20623152 CCAGCCCCCCAGTTCTCCCCAGG - Intronic
928080705 2:28309928-28309950 CAAGCTCACCCGTCCCTCCTGGG + Intronic
928450335 2:31372456-31372478 GAAGCTCACCAGTGTCCCCTGGG - Intronic
929007720 2:37411838-37411860 CAACCTCTCCTGATCTCCCTGGG - Intergenic
929732891 2:44514603-44514625 CAATCTCAATAGTTCTTCCTTGG - Intronic
936929337 2:117771327-117771349 CGAGCTCATCATTTCTTCCTGGG - Intergenic
938697578 2:133848530-133848552 CACCCTCCCCAGTCCTCCCTGGG - Intergenic
938730300 2:134142032-134142054 CAAGTTCCCCTGCTCTCCCTTGG - Intronic
943085839 2:183310224-183310246 AAAGCTCCCCAGTACTCCTTAGG + Intergenic
945037201 2:205714659-205714681 CCATCTCTCCATTTCTCCCTGGG + Intronic
946087634 2:217190148-217190170 CATGTGAACCAGTTCTCCCTGGG - Intergenic
947224049 2:227822986-227823008 CAAGAACACTACTTCTCCCTGGG - Intergenic
947832389 2:233150789-233150811 AGAGCTAACCAGTCCTCCCTCGG - Intronic
948107516 2:235427461-235427483 CAAGGACACCAGATCTCCCGAGG + Intergenic
1168799614 20:635636-635658 CCAGCCCACCATTTCTCCCAAGG - Intergenic
1169293832 20:4375566-4375588 AAAGCTTCTCAGTTCTCCCTCGG - Intergenic
1171387461 20:24779915-24779937 CTAGCTCTCCAGTCCTCCCAGGG - Intergenic
1172792650 20:37516717-37516739 GAAGATCACCTGTTCTACCTAGG - Intronic
1173351121 20:42246443-42246465 CATGATCACCATTTCTCCCCAGG - Intronic
1174176826 20:48650565-48650587 CAAGCCAACCAGAACTCCCTTGG + Intronic
1175064605 20:56274130-56274152 CAAGCTCCCCAGCTCCCTCTGGG - Intergenic
1175641420 20:60633631-60633653 CAAGCTCAACAGTCCTGCCATGG - Intergenic
1176218970 20:63961115-63961137 CAAGCCTCCCAGTTCTCCCAGGG + Intronic
1179501611 21:41812823-41812845 CACACTCCCCAGTTCTCCCCTGG - Intronic
1180750485 22:18121133-18121155 CATGATCGCCAGTTCTTCCTTGG + Intronic
1181029072 22:20141324-20141346 CAACCTCACCAGCACTGCCTGGG - Exonic
949705179 3:6808282-6808304 CAAGATGACAAGTTCTCCCAGGG - Intronic
954595417 3:51819999-51820021 CAAGTTCAAAAGCTCTCCCTGGG + Intronic
954751606 3:52817229-52817251 CAATCTCTCCACTTGTCCCTTGG + Intronic
956472440 3:69581736-69581758 CAAGCTCTCCTCTTCTCCCTGGG - Intergenic
958763960 3:98342721-98342743 CAAGCTCCCCACTTCTCCCTGGG - Intergenic
963599686 3:147367812-147367834 AGGGTTCACCAGTTCTCCCTTGG - Intergenic
966597324 3:181736475-181736497 CAAGCTCTCCCGTTCTCCCTGGG + Intergenic
967134726 3:186503719-186503741 CAAGCCCCCCACTTCTCCCAGGG - Intergenic
968577844 4:1376236-1376258 CCGGCTCACCAGGCCTCCCTGGG + Intronic
968581265 4:1396408-1396430 CATGCCCACCAGTCCTCCCTTGG - Intergenic
969223044 4:5773795-5773817 CAAGCTCACCTGTGCTCTCCAGG + Intronic
969268992 4:6086081-6086103 CAAGGTCACCAGTGCTCTCCTGG + Intronic
974384980 4:61192488-61192510 CAAGCTAATCAGTTCTTCTTAGG - Intergenic
974565551 4:63575447-63575469 CAAGCTCTCCAGCTTTCTCTGGG + Intergenic
977026601 4:91826531-91826553 CCAGCTCACAATTTCTCCCTTGG - Intergenic
979798223 4:124874151-124874173 CAAATTCCCCAGTTCTCTCTTGG - Intergenic
982033522 4:151324743-151324765 CGAGCTCACCAGTTTTCTGTAGG - Intronic
982157550 4:152536416-152536438 CAAGCTCTCCAGGCCGCCCTCGG - Intergenic
983170779 4:164534128-164534150 CAACCTCTCCACTTCTACCTTGG - Intergenic
986363282 5:7003062-7003084 TAAGCTCAGCAGTGTTCCCTAGG + Intergenic
987121592 5:14772992-14773014 CATGCTCCAGAGTTCTCCCTGGG + Intronic
987149838 5:15027588-15027610 CACACTCACCAGATCGCCCTCGG - Intergenic
988603920 5:32664374-32664396 CAAGCTCCCCAGTTTTCCCTGGG + Intergenic
990107738 5:52285428-52285450 CAAGCTCAGCACTTCTCCAGTGG - Intergenic
990789873 5:59465171-59465193 CAGCCTCACCAGCCCTCCCTTGG + Intronic
991028117 5:62052499-62052521 CAAGTCCAACAGTTCTCCCAAGG + Intergenic
993997688 5:94742511-94742533 CAAACCCACAAGTGCTCCCTGGG + Intronic
995990162 5:118228791-118228813 CAAGCCCATCACTTCTTCCTGGG - Intergenic
998695986 5:144640138-144640160 ACAGTACACCAGTTCTCCCTAGG - Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999237996 5:150111337-150111359 CCAGCTCACCCGTCTTCCCTGGG + Intronic
1001192964 5:169647592-169647614 CAAGCTCACCAGTTCTCCCTGGG + Intronic
1001978891 5:176023965-176023987 CAAGCTCACCATATCACACTGGG + Intronic
1002238524 5:177819801-177819823 CAAGCTCACCATATCACACTGGG - Intergenic
1002618313 5:180468970-180468992 CAACCTCTCCAGCTCTGCCTGGG - Intergenic
1004513187 6:16299011-16299033 CCCGCTCACGAGTTCTCCCTGGG - Intergenic
1006227709 6:32554418-32554440 CAGGGTCACCCGGTCTCCCTGGG - Intronic
1008346612 6:50434993-50435015 CAAGCTGAACAGTTTTCCTTTGG + Intergenic
1009897488 6:69771168-69771190 CAAGCTCAGAATTTCTCCCAAGG + Intronic
1011027996 6:82890456-82890478 CAAGCTCAACAGGTCTCCATTGG - Intergenic
1011042386 6:83044612-83044634 AGAGCTCCCCAGTTCTCACTCGG + Exonic
1018047280 6:159977033-159977055 CCAGCTTACCAGTTCTCCCATGG + Intronic
1019644109 7:2120029-2120051 CAGGCCCTCCAGCTCTCCCTGGG + Intronic
1022452211 7:30525798-30525820 CACCTTCACCAGTTGTCCCTGGG - Intronic
1028106714 7:86887385-86887407 AAAGTTGACCAGTTCTTCCTGGG + Intronic
1030075417 7:105732579-105732601 CATACTCAGCAGTTGTCCCTGGG - Intronic
1033444655 7:141409894-141409916 CAAACTCACCCTTTCTTCCTTGG + Intronic
1034874193 7:154710576-154710598 CGAGCTCACCAGGACTCCTTAGG + Intronic
1040846318 8:51845687-51845709 GAAGCTCTCCAGTTTTTCCTTGG + Exonic
1041616715 8:59915874-59915896 CAAGCTCATCAGTGCTCTGTGGG + Intergenic
1042887074 8:73564095-73564117 CCAGATCACAACTTCTCCCTTGG + Intronic
1048865714 8:138760234-138760256 CTCGCTCACCTTTTCTCCCTGGG + Exonic
1048957208 8:139546988-139547010 CCAGTTCACCATTTCTCCCTAGG - Intergenic
1049765940 8:144355227-144355249 CAAGCTCACCAGTGTCCCCGAGG + Intronic
1050108160 9:2187015-2187037 CAACATCATCAGTTCCCCCTGGG - Intronic
1054965927 9:71026636-71026658 CGAGCCCACCAGTGCTCCCATGG - Intronic
1060431847 9:123557264-123557286 CACACTCACCTGCTCTCCCTGGG - Intronic
1061199182 9:129126690-129126712 CCAGCTCTCCCATTCTCCCTAGG - Intronic
1062505992 9:136876848-136876870 CAGGCTCAGCTCTTCTCCCTTGG - Intronic
1187354611 X:18555277-18555299 CTAGTTCAATAGTTCTCCCTTGG - Intronic
1189263123 X:39692185-39692207 CCAGCTCACCATTCCTCCCTGGG + Intergenic
1194123708 X:89989633-89989655 CAAGCTCCCCAGCTTTCTCTGGG + Intergenic
1196596242 X:117548886-117548908 CAAGTTCACCAGTTCCCCATGGG - Intergenic
1197205686 X:123788097-123788119 CAATGACACCAATTCTCCCTTGG - Intergenic
1200476593 Y:3647254-3647276 CAAGCTCCCCAGCTTTCTCTGGG + Intergenic