ID: 1001195622

View in Genome Browser
Species Human (GRCh38)
Location 5:169670918-169670940
Sequence TTGTATTTGCATAATGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001195616_1001195622 15 Left 1001195616 5:169670880-169670902 CCCACCCTAGCGAAGGAGGACAT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1001195622 5:169670918-169670940 TTGTATTTGCATAATGTAGTTGG 0: 1
1: 0
2: 1
3: 17
4: 221
1001195619_1001195622 10 Left 1001195619 5:169670885-169670907 CCTAGCGAAGGAGGACATAACAA 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1001195622 5:169670918-169670940 TTGTATTTGCATAATGTAGTTGG 0: 1
1: 0
2: 1
3: 17
4: 221
1001195617_1001195622 14 Left 1001195617 5:169670881-169670903 CCACCCTAGCGAAGGAGGACATA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1001195622 5:169670918-169670940 TTGTATTTGCATAATGTAGTTGG 0: 1
1: 0
2: 1
3: 17
4: 221
1001195613_1001195622 28 Left 1001195613 5:169670867-169670889 CCTAAATAATGAGCCCACCCTAG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1001195622 5:169670918-169670940 TTGTATTTGCATAATGTAGTTGG 0: 1
1: 0
2: 1
3: 17
4: 221
1001195618_1001195622 11 Left 1001195618 5:169670884-169670906 CCCTAGCGAAGGAGGACATAACA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1001195622 5:169670918-169670940 TTGTATTTGCATAATGTAGTTGG 0: 1
1: 0
2: 1
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001195622 Original CRISPR TTGTATTTGCATAATGTAGT TGG Intronic
900836989 1:5012617-5012639 TTGTATTTGCATAAGGAAGGGGG + Intergenic
900898123 1:5498087-5498109 TTGTCTTTGCATATTTAAGTGGG + Intergenic
902068872 1:13714558-13714580 TTGTTTTTTAATAAGGTAGTTGG - Intronic
902422665 1:16293645-16293667 CTATATTTGCCTAATGTAGGTGG + Intronic
906875641 1:49535440-49535462 TGGTATTTATATAATTTAGTGGG + Intronic
911280316 1:95918304-95918326 TTGTATTTTCACAATTTAGATGG + Intergenic
911871349 1:103104461-103104483 ATGTATTTGCATAACATAATTGG - Intronic
912211184 1:107558882-107558904 TTGAATTTGCATAATTGAGAGGG + Intergenic
912578921 1:110703012-110703034 ATGTATTTGAATAATGAAGAGGG - Intergenic
912944060 1:114069998-114070020 TTGTATTTACATTTTGTAGTTGG + Intergenic
916920246 1:169459200-169459222 TTTTATTTGCATTATGAAATAGG + Intronic
918368813 1:183838115-183838137 TTTTATTTGAAAAATGTGGTCGG + Intronic
919162288 1:193846118-193846140 TTGTATTTCCAAAATGGATTAGG + Intergenic
923837327 1:237626978-237627000 TTTTATTTGCATTTTGTATTTGG + Intronic
1063396295 10:5691257-5691279 TTGTTTTTACATAATGTAGGAGG + Intronic
1063497381 10:6522678-6522700 TTGTATTACTATAATTTAGTGGG + Intronic
1063578651 10:7285207-7285229 TTGTATTTGTATAATGGAACAGG - Intronic
1066671547 10:37845505-37845527 TTGTCTTTTCATAATGTTTTGGG - Intronic
1071854259 10:89607362-89607384 TTATATGGGCATAATGTGGTGGG + Intronic
1072496549 10:95966865-95966887 CTGTTTTTGCATAATGTTCTAGG - Intronic
1074996533 10:118761840-118761862 TTGTGAATGCATAATGCAGTTGG + Intergenic
1075216714 10:120542871-120542893 GTGCATTTGCAACATGTAGTGGG + Intronic
1077887783 11:6398739-6398761 TTGGATTTGCAGAGTGGAGTGGG - Intronic
1078954228 11:16171897-16171919 TTGTAGTTGGAAAATGTACTGGG + Intronic
1079869175 11:25774967-25774989 TTGTGTTTCCATAATGTAAGTGG + Intergenic
1081045742 11:38270865-38270887 ATGTCTTAGCATGATGTAGTAGG + Intergenic
1082741398 11:56915253-56915275 TTGTATTTGGATTGTATAGTTGG - Intergenic
1082923282 11:58519004-58519026 TGGGATTTGCATAATTCAGTAGG - Intergenic
1086723516 11:90150893-90150915 TTATATCTGAATAATGAAGTGGG - Intronic
1088514207 11:110611733-110611755 TTGTATTTCCATAAGGCAATGGG + Intronic
1092033259 12:5307709-5307731 CTGCATTGGCATAGTGTAGTAGG - Intergenic
1092151214 12:6250263-6250285 TTGTATTTGCATCTGGTAGGTGG - Intergenic
1093044729 12:14429973-14429995 TTGTATTAGAAAAATATAGTAGG + Intronic
1093061053 12:14604875-14604897 TTTTATTTGCATAATTATGTTGG + Intergenic
1094232302 12:28120494-28120516 TTGTATTTGCATGGAGAAGTGGG - Intergenic
1094473092 12:30821683-30821705 TTGTTTTTGCATTATCTTGTGGG + Intergenic
1094636112 12:32228202-32228224 TCGTTTTTGCATAAAGGAGTTGG + Intronic
1094747356 12:33360744-33360766 TTGAATTTGCACAATTTTGTAGG - Intergenic
1096064888 12:48731800-48731822 TGGTATTTGCATATAGTAGTTGG - Intergenic
1097537154 12:60886790-60886812 ATGTATTTGCATAGTTTAGAAGG + Intergenic
1097607349 12:61771577-61771599 ATGTATTTGCATAATTTTGAGGG - Intronic
1100247502 12:92776209-92776231 ATGTACCTTCATAATGTAGTTGG - Intronic
1101484887 12:105146430-105146452 TTGTATGTGTATTATGTTGTAGG + Exonic
1101513915 12:105417279-105417301 ATGACTTTCCATAATGTAGTTGG - Intergenic
1102834062 12:116037123-116037145 TTGTATTGTAATAATGTACTTGG - Intronic
1104069666 12:125333421-125333443 TTCTATTTGCCGTATGTAGTGGG - Intronic
1106053382 13:26213521-26213543 TTGTATCTGCACAATTCAGTAGG - Exonic
1106354862 13:28971601-28971623 TTTTATTTGCATTATATAATGGG + Intronic
1107564316 13:41586425-41586447 TTGTATTTGTATCCTGTACTTGG + Intronic
1108535857 13:51377165-51377187 TTGTATTTGCATATTTTCTTTGG + Intronic
1109065888 13:57689650-57689672 CTGTATATGCATAATGCAATCGG + Intronic
1110138621 13:72100126-72100148 TTGTATTTCCATAAGTTATTGGG - Intergenic
1110512409 13:76366494-76366516 ATAGATTTGCATATTGTAGTAGG - Intergenic
1111036980 13:82688390-82688412 TTATTTTTGAATAATGTAATAGG + Intergenic
1115045291 14:28984897-28984919 ATTTACTTGGATAATGTAGTAGG + Intergenic
1115086857 14:29526400-29526422 TTCTATTCCCATAATGTATTAGG + Intergenic
1115780950 14:36767686-36767708 ATGTATTAGCATAATGGATTGGG - Intronic
1116074592 14:40094370-40094392 TTATATTTGCATATTTTGGTAGG - Intergenic
1116324239 14:43511281-43511303 TTCTATTTGTATAATATACTTGG - Intergenic
1116375435 14:44193360-44193382 TTATATGTGCAAAATGTGGTTGG + Intergenic
1117833010 14:59772184-59772206 TTGTTTTTATATAATGTAATTGG + Intronic
1119047217 14:71329707-71329729 TTGTATTTTCATATTCTCGTTGG + Intronic
1119119530 14:72061427-72061449 ATGTGTTTGCATAATGAAGAAGG + Intronic
1119998062 14:79274758-79274780 TTGAGTTTGAATAATGTAGCTGG - Intronic
1120857715 14:89227091-89227113 TGGTCTTTGTATAATGTAATAGG - Intronic
1121802135 14:96783573-96783595 TTGTATTTGGATATTGAATTTGG + Intergenic
1121968575 14:98334939-98334961 TTTTTTTTCCATAATGTATTTGG - Intergenic
1124199647 15:27667965-27667987 TTGTATTTGAGCTATGTAGTTGG + Intergenic
1126233940 15:46359930-46359952 GTGTAATTTTATAATGTAGTTGG - Intergenic
1126244799 15:46491931-46491953 TTGTATTTGCATAGTTTTGAGGG - Intergenic
1127126110 15:55813453-55813475 TTGTTTTTGCATTGTGTGGTGGG - Intergenic
1127941482 15:63701962-63701984 TTGTATTTTCTTTATATAGTAGG - Intronic
1128431338 15:67597542-67597564 TTGTATTTAAATATTATAGTTGG - Intronic
1130844531 15:87732590-87732612 TTGTCTTTGCATTATTTAGAAGG + Intergenic
1133518362 16:6531900-6531922 TTCTTTTTGCTTAATGTAGAAGG - Intronic
1133819055 16:9220569-9220591 TTGTATTCACTTAATGTAGTGGG + Intergenic
1134848925 16:17464740-17464762 TTGTATTTGCATCATGAGTTAGG + Intronic
1135181489 16:20278381-20278403 TTTTATTTCCATTTTGTAGTAGG + Intergenic
1137806345 16:51309610-51309632 TTTTCTTTGAAAAATGTAGTTGG + Intergenic
1141963437 16:87424912-87424934 TTTCTTTTGCATAATGTATTTGG - Intronic
1142732839 17:1873396-1873418 TTGGATTTGTAGAATGTGGTTGG + Intronic
1147061945 17:37886989-37887011 TTATATTTTTATAATTTAGTTGG - Intergenic
1149442043 17:56682494-56682516 TTGTATTTGCATGGCGTAGGTGG - Intergenic
1152018536 17:77768151-77768173 TTGCACTTGGATAATGCAGTGGG + Intergenic
1153754115 18:8262674-8262696 CTGTGTTTGAATAATATAGTAGG + Intronic
1155870756 18:31024845-31024867 CTTTATTTAGATAATGTAGTAGG - Intronic
1156326903 18:36082305-36082327 TTGTATTTGCATAGTTTTGAGGG - Intergenic
1156974909 18:43208760-43208782 TTATATTTGAATAATTTAGGTGG - Intergenic
1158294653 18:55982146-55982168 TTGTCTTTACATAATGTTTTTGG + Intergenic
1158444276 18:57505263-57505285 TAGTATTTCCAAAATGGAGTTGG - Intergenic
1159575903 18:70177037-70177059 TTGTATTTTTAAAATGTAGGTGG - Intronic
1164554180 19:29237601-29237623 TTCTATTTGCCTAATCTATTTGG - Intergenic
1164897428 19:31889267-31889289 TTGTATTTGTTTAATGAGGTTGG + Intergenic
1165221985 19:34323916-34323938 TTCTATTTGCTCAGTGTAGTAGG - Intronic
1168484961 19:56753503-56753525 TTGAATTTGTACAATGTATTGGG - Intergenic
927285087 2:21348874-21348896 TTCTATTTTCTTAATGTATTTGG - Intergenic
929276856 2:40035072-40035094 TTGGCTTTGCATAATGTGCTAGG + Intergenic
931136773 2:59411802-59411824 CTGTATTTGCATAATTTTGAGGG + Intergenic
931353674 2:61515255-61515277 TTGTATTTGCCTTATTTATTAGG - Intronic
933338642 2:80993550-80993572 TTGTATTTGAAGATTGTATTGGG + Intergenic
937371494 2:121300904-121300926 ATGTATTTGTATAAAGTATTAGG - Intergenic
942505279 2:176635685-176635707 TTGTTTATGCAGAAAGTAGTAGG + Intergenic
944954534 2:204793133-204793155 TTGTATTTGCAAAATATATGAGG + Intronic
945200374 2:207275149-207275171 TTCCAGTTGCCTAATGTAGTAGG + Intergenic
946768959 2:223068391-223068413 GGGTATTTTCATAATGAAGTCGG + Intronic
1170234015 20:14081716-14081738 TTGTATTTGCAAAGAATAGTTGG + Intronic
1170311272 20:14995039-14995061 TTGTATTTCCATTATATATTTGG - Intronic
1172115123 20:32569153-32569175 TTGTCTTTTCAAAATGTCGTTGG - Intronic
1174490756 20:50893259-50893281 GTGTATTTTCATAATGTAGTTGG + Exonic
1175580898 20:60098493-60098515 TTGTATTTGCATAAACTCTTTGG - Intergenic
1176791913 21:13327998-13328020 TTGTATTTCAATTTTGTAGTTGG + Intergenic
1180929590 22:19579827-19579849 GTGTGTTTTCATAATGAAGTTGG - Intergenic
1181667430 22:24407769-24407791 TTGCATTTTCATTTTGTAGTGGG + Intronic
1181912425 22:26249900-26249922 TTGTATTTTCCTGATGTAGTAGG + Intronic
1184963140 22:47946147-47946169 CTGTATTTGCATATTCCAGTTGG + Intergenic
949973410 3:9431386-9431408 TTACATTTGCATAAAGTGGTTGG + Intronic
951083528 3:18481902-18481924 TTTTAATTGCATAATTTGGTAGG + Intergenic
951744027 3:25956757-25956779 TTATATTTGCTTCATGAAGTTGG - Intergenic
951967392 3:28401771-28401793 ATGTATTTGCATAATTTTGAAGG - Intronic
952239215 3:31512489-31512511 TTTTATTTGTATAAAGTTGTGGG + Intergenic
954886399 3:53878264-53878286 TTGTATTTGCATAGTGGTATAGG + Intronic
955205535 3:56892674-56892696 TTGAATTTGAATTATGCAGTTGG - Intronic
955345748 3:58160676-58160698 CTGTATTTGTATAGTGTAGTTGG + Intronic
955626170 3:60921902-60921924 TAGTAATTTAATAATGTAGTCGG + Intronic
957417502 3:79925111-79925133 ATGTATTTGTATATTGTACTAGG + Intergenic
957805217 3:85139444-85139466 TTGTAATTGCATTATCTAGTTGG + Intronic
957938097 3:86969540-86969562 TTGTATTTGCATTTAGAAGTTGG - Intronic
958521795 3:95199253-95199275 TTGTATTTTCCTTATGTGGTTGG - Intergenic
959227668 3:103605981-103606003 TTATATTTGCCTTATGTATTTGG - Intergenic
959258611 3:104047543-104047565 TTATATTTACAAAATGTAGAAGG - Intergenic
959920713 3:111865327-111865349 TTGTTTTAGCATAACATAGTGGG - Intronic
959986073 3:112572481-112572503 TTGAATTTGCATAATTTTGTTGG - Intronic
961505056 3:127365044-127365066 TTGTAATTCCATAATGTATATGG + Intergenic
962100588 3:132338172-132338194 TTGTATATGCATAAGGAAATTGG - Intronic
964413092 3:156419669-156419691 TTATATTTGCATAACTTTGTAGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966021217 3:175213591-175213613 ATGCATTTACATAGTGTAGTAGG + Intronic
967497424 3:190156974-190156996 TAGTATTTGCATAATGTTTTTGG - Intergenic
970017610 4:11530413-11530435 TTGGATGTGTAAAATGTAGTGGG - Intergenic
970717374 4:18941820-18941842 TTGTATTGGAATACTGTATTAGG - Intergenic
971646677 4:29215663-29215685 TTGTAGTTGCATGATGTTATTGG - Intergenic
971763091 4:30794397-30794419 TTGAATTTGTATAATACAGTAGG + Intronic
971783790 4:31074457-31074479 ATGTCTTTGCATAATGTAGAGGG - Intronic
971979534 4:33734706-33734728 TTGTATTTAAATTTTGTAGTTGG + Intergenic
974663891 4:64932841-64932863 TTGTATTTGATTAATGTAAATGG + Intergenic
976479984 4:85530896-85530918 TTGCATTTGCATAATGTGCAGGG + Intronic
976879560 4:89902666-89902688 TTTTATTTGCTTTCTGTAGTGGG - Intronic
977144203 4:93415580-93415602 TTGTAATTGCCTAATGTGTTTGG + Intronic
978087668 4:104673909-104673931 ATGTATTTGCATAGTTTTGTGGG + Intergenic
980241286 4:130179500-130179522 CTGTATGTGCATAATGTATGTGG - Intergenic
980761177 4:137236333-137236355 ATGTATTTGCATAATTTAGGGGG + Intergenic
980783528 4:137522486-137522508 TTGTATTTGCCAAATGTAGAGGG - Intronic
983098428 4:163594554-163594576 TTTTATTTAAATTATGTAGTGGG - Intronic
983116739 4:163827388-163827410 TTTTATTTTCATAATGTCATTGG - Intronic
987017029 5:13831091-13831113 TTGCATTTCCAAAATGTATTTGG + Intronic
987292002 5:16517725-16517747 TTGTAGTTGCACAATATATTTGG - Intronic
987739696 5:21891002-21891024 TGGAATTTTCACAATGTAGTTGG - Intronic
987868721 5:23582438-23582460 TTGTAATTACATAATGTAATTGG - Intergenic
989167126 5:38443358-38443380 TTGAATTTGGCTCATGTAGTTGG - Intronic
991220532 5:64210494-64210516 TTATATTTGTATTATGTTGTGGG + Intronic
991253126 5:64585748-64585770 TTGTTTATGGATAATGTAATAGG - Intronic
992975641 5:82116213-82116235 TTGCATTTCCATATAGTAGTTGG + Intronic
994828844 5:104750909-104750931 TTTTGTGTGCATAATTTAGTGGG + Intergenic
995122414 5:108550142-108550164 TTGTATTTGCAAGATGTCTTAGG + Intergenic
995260795 5:110102275-110102297 TTGTATTTGCATGATGGTCTAGG - Intergenic
996802387 5:127418205-127418227 ATGTATTTACATTCTGTAGTTGG + Intronic
997281945 5:132654873-132654895 TTGTATTTACATAAACTAATAGG + Intergenic
998218810 5:140258397-140258419 TTGTATTTGCACAATTCACTGGG - Intronic
999636625 5:153629638-153629660 ATGCATTTGCACTATGTAGTAGG + Intronic
1000827467 5:166063559-166063581 GTGTTTTTTCATCATGTAGTAGG - Intergenic
1001195622 5:169670918-169670940 TTGTATTTGCATAATGTAGTTGG + Intronic
1003367854 6:5493917-5493939 TGGTATTTTCATAATATAGAGGG - Intronic
1005020894 6:21417807-21417829 TTGGATTTGCATAATGTTGACGG - Intergenic
1005202995 6:23368200-23368222 TTCTATTTGCTTAATCTTGTAGG + Intergenic
1005515095 6:26547078-26547100 TTGTATCTGCATATTCTTGTGGG + Intergenic
1008468648 6:51858376-51858398 TTTTATTTGCTAAATATAGTTGG - Intronic
1010388781 6:75312671-75312693 TTGTATTTCCGTACTGGAGTTGG + Exonic
1010393503 6:75363662-75363684 GTGTATTTGCATTATGTGATGGG - Intronic
1010638846 6:78296719-78296741 TTCTATTTGCTTAGGGTAGTGGG - Intergenic
1011168875 6:84481838-84481860 ATGTATTTGCATAGTGTCGAAGG - Intergenic
1011572195 6:88750197-88750219 TAGTATTTGCCTGGTGTAGTGGG - Intronic
1011998816 6:93627453-93627475 CTGAATTTGGATCATGTAGTTGG - Intergenic
1012921036 6:105221335-105221357 TTGTATTTAAATTTTGTAGTCGG + Intergenic
1014893378 6:126870090-126870112 TTGTATCTGCATGTTGTATTTGG - Intergenic
1016499765 6:144706612-144706634 ATGTATTTGCAGAATGTCATTGG - Intronic
1016851961 6:148629399-148629421 TTGAGTTTGCATATTGTACTAGG + Intergenic
1017985260 6:159437905-159437927 TTGGATTTGAATAAAGAAGTTGG - Intergenic
1021167445 7:17358939-17358961 GTGTATTTGTCTAATGTAGGTGG + Intergenic
1022647897 7:32248529-32248551 TTGTATTTGTGTAATTCAGTGGG - Intronic
1024555925 7:50603701-50603723 TTTTATCTTCATAAGGTAGTGGG - Intronic
1027733021 7:81900103-81900125 ATGTATTTGTATAGTTTAGTAGG + Intergenic
1030368331 7:108671331-108671353 TTCTATTTGTATAATTAAGTAGG - Intergenic
1032941254 7:136795248-136795270 TTTTATTTGCATAACACAGTTGG + Intergenic
1035872905 8:3155090-3155112 TTATATTTGCAAAATATAATAGG - Intronic
1037511925 8:19592236-19592258 TTGAATTTGCCTAATGTACTGGG - Intronic
1039455489 8:37703195-37703217 TTGTATTCACATAATGCAGGTGG + Intergenic
1039722839 8:40183140-40183162 TTCTTTTTGCATAAGGTGGTGGG - Intergenic
1039779728 8:40772562-40772584 TTGTATTTGCATAATGCTTCAGG + Intronic
1040440392 8:47435787-47435809 ATGTCTTAGCATAATGAAGTAGG + Intronic
1040594964 8:48828544-48828566 CTTTATTTGTATAATGTAGTTGG - Intergenic
1042233422 8:66582835-66582857 TAGTATTTGCTTGATGTAGCTGG - Intronic
1042675422 8:71315548-71315570 CTGCAATTGCATAATTTAGTTGG + Intronic
1043760871 8:84066226-84066248 TAGAATTTTCATAATGTATTTGG - Intergenic
1043943442 8:86223179-86223201 TTGTATTTGTATAAATTAATGGG + Intronic
1044529243 8:93289359-93289381 TTGTATTTTCATCATTTAGGGGG - Intergenic
1045486922 8:102638759-102638781 TTATATTTGCATAATTAAGAGGG - Intergenic
1046214548 8:111126719-111126741 TTCTGTTTGCAAAATGTATTAGG + Intergenic
1049125355 8:140782138-140782160 TTTTATGTGCACAAAGTAGTAGG - Intronic
1050604350 9:7285073-7285095 ATGCCTTTGCATACTGTAGTGGG - Intergenic
1050638168 9:7636100-7636122 TTGTATTTTCATAATATTTTGGG - Intergenic
1051817021 9:21120468-21120490 TTGTGTTTGCATAAAGGAGAAGG + Intergenic
1051872181 9:21750778-21750800 TTGTATTTTCATATAGTAGCTGG - Intergenic
1052053449 9:23876097-23876119 TTGTCTTTGGGGAATGTAGTGGG - Intergenic
1055277623 9:74636909-74636931 TGGTATTAGCATAATTTACTTGG - Intronic
1056219869 9:84440755-84440777 ATCTGTTTCCATAATGTAGTTGG + Intergenic
1058902533 9:109454574-109454596 TTGTTTTTGAAAAATGTTGTAGG - Exonic
1060364049 9:122990884-122990906 TTGTATTTGCTTGTTTTAGTTGG + Intronic
1060491292 9:124086685-124086707 TTGTATTTGGACCATGTATTTGG - Intergenic
1060715558 9:125925019-125925041 TTGTATTTGCACATTGAAGGAGG - Intronic
1185959452 X:4532781-4532803 TTTTTTTTGCATAATTCAGTGGG + Intergenic
1186028066 X:5335865-5335887 CAGTATTTTCATAATGCAGTTGG + Intergenic
1186584179 X:10853948-10853970 TTCTATTTGCATGATGTGGAAGG - Intergenic
1186869519 X:13756841-13756863 TTGTACTTGTATAAGGTAGGGGG + Intronic
1187785412 X:22879796-22879818 GTCCATTTCCATAATGTAGTAGG - Intergenic
1187992307 X:24888218-24888240 TAGTATATGCATATGGTAGTAGG - Intronic
1189065643 X:37805381-37805403 TTGTATTTGTATAGTGTTGCTGG + Intronic
1190861777 X:54352149-54352171 TTGTATTTCCCTAATGATGTTGG - Intronic
1190940773 X:55038683-55038705 TTGTAATTTCATAATTTACTAGG + Intergenic
1193775739 X:85639522-85639544 TTGTATTTGCATAGTTTCGAGGG + Intergenic
1194014499 X:88602776-88602798 ATGTATTTGCATAATTTTGAGGG + Intergenic
1194067005 X:89273626-89273648 TTCTATTTGGATCATGTATTTGG + Intergenic
1195449321 X:104992505-104992527 TTATTGCTGCATAATGTAGTTGG + Intronic
1195738725 X:108040275-108040297 TTGTATTTCTGTAATGTGGTTGG - Intergenic
1196171130 X:112589913-112589935 ATGTATTTGCATAGTTTTGTAGG - Intergenic
1196327423 X:114423655-114423677 TTAGATTTGCATAATGAAATTGG + Intergenic
1196381398 X:115094224-115094246 TACTATTTGCATTATGTATTTGG - Intergenic
1198748611 X:139916481-139916503 TTACATTTGCATACTGTATTTGG - Intronic
1200143096 X:153911545-153911567 TTGTATTTGCAAATTGTTGCTGG + Intronic
1200721166 Y:6607821-6607843 TTCTATTTGGATCATGTATTTGG + Intergenic
1201747961 Y:17401276-17401298 TTTTTTTTGCATAATTCAGTAGG + Intergenic