ID: 1001197161

View in Genome Browser
Species Human (GRCh38)
Location 5:169684174-169684196
Sequence ACTGAAAGGCAGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1198
Summary {0: 1, 1: 1, 2: 11, 3: 149, 4: 1036}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001197161_1001197166 12 Left 1001197161 5:169684174-169684196 CCTTCTTCCTTCTGCCTTTCAGT 0: 1
1: 1
2: 11
3: 149
4: 1036
Right 1001197166 5:169684209-169684231 CAGATTATGCAATGTATTCCCGG 0: 1
1: 0
2: 2
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001197161 Original CRISPR ACTGAAAGGCAGAAGGAAGA AGG (reversed) Exonic
900011116 1:109611-109633 TGTGAAAGACAGAAGAAAGAGGG + Intergenic
900027220 1:286175-286197 TGTGAAAGACAGAAGAAAGAGGG + Intergenic
900753041 1:4411762-4411784 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
900913743 1:5620171-5620193 ACTTGAAGGCAGAAACAAGAAGG + Intergenic
902091081 1:13903747-13903769 AGTGATGGGCAGGAGGAAGACGG + Intergenic
902399651 1:16150963-16150985 ACTGAAAGGGAGAAGGGAGAGGG + Exonic
902780499 1:18701829-18701851 AGGGATAGGCAGAGGGAAGAAGG + Intronic
903011056 1:20330725-20330747 AGGGAGAGGGAGAAGGAAGAGGG - Intronic
903260173 1:22127391-22127413 ACTCAAAGGCGCAAGGAAGGAGG - Intronic
903359648 1:22768868-22768890 ACAGCAAGGCAAAAGGAGGAGGG - Intronic
903360576 1:22774431-22774453 GCTGCCAGGAAGAAGGAAGAAGG + Intronic
904897766 1:33829929-33829951 ACTGCAAGGCAGCAGCAAGGCGG + Intronic
905051894 1:35058911-35058933 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
905394778 1:37660192-37660214 ACAGAGAGACAGAAGGCAGAAGG - Intergenic
905490681 1:38341182-38341204 AAAGAAAGAAAGAAGGAAGAAGG - Intergenic
905659969 1:39714325-39714347 ACTGCAAGGCTGAAGGAGGAAGG + Intronic
906877314 1:49552989-49553011 ACTTAAAGGCAGAAGGATTGAGG - Intronic
906897514 1:49792553-49792575 ACTGAAAGCCAGAAGATAGCTGG + Intronic
907699083 1:56765785-56765807 TCTGAAAGGTAGAGAGAAGAAGG - Intronic
907718152 1:56946981-56947003 AGGGTAAGGGAGAAGGAAGAGGG - Intronic
907958031 1:59250168-59250190 ACTAAAATGCAGTGGGAAGAAGG + Intergenic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908280326 1:62527193-62527215 TCTTAAAGGCAGAAGGATCAGGG - Intronic
908530291 1:65027562-65027584 TGTGAAAGGCAAAAGGAAGAGGG + Intergenic
909058691 1:70853392-70853414 AGTGAATGGCTGAAGGAAAAGGG + Intronic
909099781 1:71336210-71336232 ACTGAGGGGCAGAAGTTAGAAGG + Intergenic
909181055 1:72424615-72424637 ACTTGAGGGTAGAAGGAAGAAGG + Intergenic
909377624 1:74958026-74958048 ATTTAAAGGCACAAGGTAGAAGG - Intergenic
909431659 1:75594749-75594771 AGAAAAAGGCAGAGGGAAGATGG + Intronic
909852869 1:80490946-80490968 ACTGACAGGCAGAAGCTACATGG + Intergenic
909875663 1:80799419-80799441 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
910022658 1:82611089-82611111 ACTGTAAGGTAGAGAGAAGAGGG - Intergenic
910126619 1:83849665-83849687 ATTGAAAGGCAGTGGTAAGAGGG - Intergenic
910276175 1:85451343-85451365 ATATAAAGGCAGAAAGAAGAGGG + Intronic
910734351 1:90435837-90435859 ACTGAATAGCAGAAGCAAGAAGG + Intergenic
911189040 1:94929500-94929522 ACCGAGAGGCATAAGGCAGAGGG + Intergenic
911210981 1:95137662-95137684 ACAGAGAGGAAGAAGGAAGAGGG - Intronic
911229147 1:95341840-95341862 ACTGAAATGCAGGTGCAAGATGG + Intergenic
911361934 1:96887306-96887328 ACGGAAAGGCAGCGGGGAGAAGG + Intergenic
911434608 1:97840695-97840717 CATGAAAGGCAGAAGCATGAGGG + Intronic
911614478 1:99993446-99993468 ACCGAGAGGGAGAAGGGAGAGGG - Intronic
911754148 1:101533394-101533416 ACTGAAAAGAACAAGGCAGATGG + Intergenic
911854469 1:102859360-102859382 ACTGAGGGGCAGAAAGCAGAAGG - Intergenic
911910529 1:103628583-103628605 ACTGAAATGGAGAGGGATGAGGG + Intergenic
911917945 1:103722708-103722730 ACTGAAATGGAGAGGGATGAGGG + Intronic
912060943 1:105669126-105669148 AATGAAAGGGAGAAGAAAGTGGG - Intergenic
912417598 1:109520637-109520659 GTTGAAAGGCAGAAGGCAGGAGG - Intergenic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912572165 1:110632741-110632763 CCTGGAGGGCAGAAGTAAGAAGG + Intergenic
912629961 1:111238443-111238465 ACTCAAAAGGGGAAGGAAGATGG + Intronic
913008868 1:114662964-114662986 AGGAAAAGGAAGAAGGAAGAGGG + Intronic
913052305 1:115128521-115128543 TCCTGAAGGCAGAAGGAAGATGG - Intergenic
913232648 1:116754518-116754540 ATTGAAAATCAGAAGGAAGCTGG - Exonic
913367066 1:118050379-118050401 ACTGAGGGGCATAAGGCAGAAGG - Intronic
913575944 1:120175174-120175196 ACTGCTAAGGAGAAGGAAGAGGG - Intronic
913664771 1:121037262-121037284 GCAGAAAGACAGAAGGAACAGGG - Intergenic
914161618 1:145140471-145140493 GCAGAAAGACAGAAGGAACAGGG + Intergenic
914440059 1:147697586-147697608 TGTGAAAGGAAGAAGGCAGAGGG - Intergenic
914558258 1:148790745-148790767 ACTGCTAAGGAGAAGGAAGAGGG - Intergenic
914614577 1:149339485-149339507 ACTGCTAAGGAGAAGGAAGAGGG + Intergenic
914726562 1:150332622-150332644 CCTGAATGGGAGAAGTAAGAAGG + Intronic
916036333 1:160925879-160925901 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
916202983 1:162289289-162289311 AAAGAAAGAAAGAAGGAAGAAGG - Intronic
916419731 1:164625860-164625882 ACAGAAAGGCAGAAGGAGGGTGG - Intronic
916504523 1:165416085-165416107 ACTGAAAGGGTCAATGAAGAGGG - Intronic
916562916 1:165948693-165948715 ACAGAAAGACAGAAAGAAGGGGG + Intergenic
916690652 1:167186936-167186958 GGTGAAGGGCAGAAGGCAGAAGG - Intergenic
916715510 1:167443732-167443754 AAAGAAAGGAAGAAGGAAGGAGG - Intronic
917307094 1:173638180-173638202 ACCGAAAGGGAAAAGGAGGAAGG + Intronic
917540656 1:175910572-175910594 ACTCAAGGGCATAAGGCAGAAGG + Intergenic
917626951 1:176855911-176855933 ACTGGAAGGAAGAAGGGAGAGGG + Intergenic
918072920 1:181146697-181146719 ACTGAATGCCAAAAGGAAGAAGG + Intergenic
918106508 1:181419920-181419942 GCTGAAAGGCAGGAGACAGAAGG - Intronic
918552651 1:185761197-185761219 ACTCAAAGGCAAAAAGGAGATGG + Intronic
919107597 1:193172717-193172739 ACAGGATGGCAAAAGGAAGAGGG - Intronic
919354067 1:196499063-196499085 ACACATATGCAGAAGGAAGATGG + Intronic
919936291 1:202252850-202252872 CTTGAAAGTCAGAGGGAAGAAGG + Intronic
919992115 1:202715225-202715247 ACTTCATTGCAGAAGGAAGAAGG - Intergenic
920127113 1:203702144-203702166 AGGAAAAGGGAGAAGGAAGATGG - Intronic
920340885 1:205274481-205274503 ACTGAAAGGGAGGAGGAAAAAGG + Intergenic
920606703 1:207396033-207396055 AGCCAGAGGCAGAAGGAAGATGG + Intergenic
921102856 1:211945884-211945906 ACTGAAAGGCAGAAGTACTTTGG + Intronic
921166637 1:212512870-212512892 ACTCAAAGGCAGAGAGAAGAGGG + Intergenic
921294847 1:213692043-213692065 ACTGAAGGACATAAGGCAGAAGG + Intergenic
921311053 1:213843795-213843817 AAAGAAAGGAAAAAGGAAGATGG - Intergenic
921350328 1:214228050-214228072 ACAGATAGGGAGAAGGAAGAAGG + Intergenic
921412288 1:214848759-214848781 GCTGAAAGGCAGGAGGAAGATGG - Intergenic
922069799 1:222180694-222180716 ACTAGAAGGGAGAAGGAAAAAGG + Intergenic
922085880 1:222346461-222346483 AATGAAAGAGAGAAGGGAGATGG + Intergenic
922174111 1:223181690-223181712 TCTGAAAGGCAGAGAGAAGGAGG + Intergenic
922259561 1:223925612-223925634 TGTGAAAGACAGAAGAAAGAGGG + Intergenic
922321047 1:224487385-224487407 ACAGAAAGACAGAAGGAGGAAGG - Intronic
922663446 1:227449452-227449474 ACTGACGGGCAGAAGGCAGAAGG + Intergenic
923027138 1:230214019-230214041 AATGAAATACAGAAGGAATATGG - Intronic
923035027 1:230279706-230279728 AGTGAAAGCTGGAAGGAAGAGGG - Exonic
923135066 1:231110216-231110238 TCTGAAAGGTAGAAAGAAGAAGG + Intergenic
923251663 1:232184153-232184175 ACAGATAGACAGAGGGAAGAGGG + Intergenic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923389446 1:233499417-233499439 ACAGAAAGGCAGAAGGAACCTGG + Intergenic
923414276 1:233739610-233739632 AGGAAAAGGCTGAAGGAAGATGG + Intergenic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923931815 1:238708834-238708856 AGTAAAAAGCAGAAGGAAAATGG + Intergenic
924136081 1:240968265-240968287 ACTGAATGCCCGTAGGAAGAGGG - Intronic
924312819 1:242763497-242763519 ACTAAAAGGCAGTACTAAGAAGG + Intergenic
924340722 1:243028168-243028190 TGTGAAAGACAGAAGAAAGAGGG + Intergenic
924480671 1:244430324-244430346 ATTGCAATGAAGAAGGAAGATGG + Intronic
924502178 1:244647996-244648018 ACTGGAAGGCAGGAGGAGGAGGG + Intergenic
924578073 1:245298716-245298738 TCTTTAAGGCAGGAGGAAGATGG + Intronic
924594059 1:245429967-245429989 ACTGAAGGGAAAAAAGAAGATGG + Intronic
924703772 1:246481195-246481217 ACAGATCTGCAGAAGGAAGATGG - Intronic
924743239 1:246809894-246809916 ATTGAAAGGCTGATGGAACAAGG - Intergenic
1062814444 10:489441-489463 ACTGACAGGCAGAAGCTAGCTGG + Intronic
1062999843 10:1906129-1906151 CCTGAAAGGAAGAAAGAAGGAGG + Intergenic
1063009884 10:2011729-2011751 ACTGGAAGGCTGAGGGGAGATGG - Intergenic
1063286257 10:4692099-4692121 ACGGGAAGGGAGAAGGGAGAAGG + Intergenic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1063604103 10:7507968-7507990 ACAGAAAGGAAGAAGGAAATAGG + Intergenic
1063652479 10:7951815-7951837 ACTGAAGTTCAGAAGGATGAAGG + Intronic
1064126031 10:12661068-12661090 GTTGAAAAGCAGAAGGAATAGGG - Intronic
1064227846 10:13503323-13503345 GCTGAAAGGAAGAGGGCAGAAGG + Intronic
1064797499 10:19029741-19029763 ACGGAAAGGGGGAAGGGAGAAGG - Intergenic
1065523966 10:26599048-26599070 ACTGAAAAGAAAAAGGAACATGG - Intergenic
1065640351 10:27776071-27776093 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
1065842280 10:29712479-29712501 ACTGAAAGGCAGAGAGGAGCTGG - Intronic
1066084421 10:31962485-31962507 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1066099450 10:32104801-32104823 AGTGGAAGGAAGAAGAAAGAGGG + Intergenic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066244188 10:33566581-33566603 ACTGAAAGGGGCAAGGAAGCTGG + Intergenic
1066345637 10:34582869-34582891 GCAGAAAGGAAGAAAGAAGAAGG - Intronic
1066556595 10:36621211-36621233 AATGAAGGGAAGAAGGAAGGAGG - Intergenic
1066731474 10:38440767-38440789 ACTGAACTCCAGGAGGAAGAGGG - Intergenic
1066735755 10:38477238-38477260 TGTGAAAGACAGAAGAAAGAGGG - Intergenic
1067954910 10:50780411-50780433 ACTGAGGGGCATAAGGCAGAAGG + Intronic
1068517700 10:58044650-58044672 ATTGAATGAAAGAAGGAAGAGGG - Intergenic
1069048817 10:63770734-63770756 ACAGGTAGGCAGCAGGAAGAAGG - Intergenic
1069065984 10:63942310-63942332 ACTGAGAGGGAGAAGGAAAATGG - Intergenic
1069174319 10:65271342-65271364 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1069734860 10:70647359-70647381 ACTGACGGGCATAAGGCAGAAGG + Intergenic
1069755282 10:70771049-70771071 ACTGAAGGGCAGATGGCAGTTGG - Intergenic
1070026548 10:72637499-72637521 TATGAAAGGGAGAAGGAAGACGG + Intergenic
1070037194 10:72737918-72737940 ACTTAAAAGCAGAAAGAATACGG - Intronic
1070286102 10:75085108-75085130 ACTGAAAGGTAGAAAGAACCGGG - Intergenic
1070521672 10:77259207-77259229 AAAGAAAGGAAGAAGAAAGAGGG + Intronic
1071010131 10:80928922-80928944 ACTGGAAGTCAGAAGGCAGTGGG + Intergenic
1071102295 10:82053294-82053316 TATTAAAGGCAGAAGGATGAGGG + Intronic
1071851237 10:89572574-89572596 ACTGAATAGCAGTAGGAGGAAGG + Intergenic
1071928540 10:90439154-90439176 ACACAAAGCCAGAAAGAAGAAGG - Intergenic
1072262688 10:93696140-93696162 TCTAAAAGGTGGAAGGAAGAAGG + Intronic
1072457260 10:95587786-95587808 TCTGAAAGGTAGGAGGAAGAGGG + Intergenic
1072879971 10:99217132-99217154 ACCGAAAGGCAGAAACAACATGG - Intronic
1073016250 10:100401942-100401964 ACAGAAAGCAAGAAGGCAGAAGG + Intergenic
1073190561 10:101647782-101647804 AATGAAAGCCTGAAGTAAGATGG - Intronic
1073444226 10:103571265-103571287 TGAGAAAGGCATAAGGAAGAGGG - Intronic
1073666942 10:105544154-105544176 TTTGAAAGGCAGAAGGTAGGAGG - Intergenic
1074096359 10:110316878-110316900 AATGAAAAGTAGAAGAAAGAAGG + Intergenic
1074290446 10:112134223-112134245 GCTGAAAAACAGAAGGGAGAGGG + Intergenic
1075070067 10:119314562-119314584 ACTCAAAGGCAGCAGGACCATGG + Intronic
1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG + Intronic
1075618987 10:123911905-123911927 ACTGAGGGGCATAAGGCAGAAGG + Intronic
1076015786 10:127026652-127026674 ACTGGAAAGCAAAAGAAAGAAGG - Intronic
1076358534 10:129870188-129870210 AAATACAGGCAGAAGGAAGATGG - Intronic
1076427536 10:130378481-130378503 ACTGAAAGGTTGAATGGAGAGGG - Intergenic
1076468693 10:130703684-130703706 CCTGAGAGGCAGTAGGAAGAAGG + Intergenic
1076530464 10:131141307-131141329 GCTCTAAGGCAGGAGGAAGAAGG - Intronic
1078169489 11:8918391-8918413 TCTGCAAGGTAGGAGGAAGAGGG + Intronic
1078389826 11:10927502-10927524 ACTTAAAGACTGCAGGAAGAAGG - Intergenic
1078541559 11:12217508-12217530 TCTGTGAGGCAGAGGGAAGAAGG - Intronic
1078612265 11:12830949-12830971 GATGAAGGGCAGGAGGAAGAAGG - Intronic
1078619712 11:12895932-12895954 ACTGAAAGGAAGACGGAGGGGGG - Intronic
1078619723 11:12895989-12896011 ACTGAAAGGAAGACGGAGGGGGG - Intronic
1078819316 11:14861685-14861707 ACTGAGGGGCATAAGGCAGAGGG + Intronic
1079083580 11:17430197-17430219 AATGAAAGCCTGAAGGTAGAAGG - Intronic
1079276118 11:19039528-19039550 ACTGCAGGCCAGAAGGAAGTAGG + Intergenic
1079398256 11:20084560-20084582 ATTGAATGGGGGAAGGAAGAAGG + Intronic
1079499576 11:21087638-21087660 GCTGAAATGCAGCAGGAAGGAGG + Intronic
1079779265 11:24578767-24578789 ACTAGAAGGCAGAAGGAGGGAGG + Intronic
1080249707 11:30219231-30219253 ACTGGAAGGAAGAAGAAGGAAGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080551868 11:33379409-33379431 ACTGGAAGCAAGACGGAAGACGG - Intergenic
1080904772 11:36531874-36531896 CATTAAAGTCAGAAGGAAGAAGG - Intronic
1081265869 11:41020519-41020541 ACAGACATGCAGAGGGAAGATGG + Intronic
1081526775 11:43933037-43933059 CCAGAAACGCAGAAGCAAGAGGG - Intronic
1082942726 11:58725608-58725630 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
1083028378 11:59570092-59570114 AATGGAGGGCAGAGGGAAGAAGG - Intergenic
1083682594 11:64358329-64358351 AGGGAAAGGCAGGAAGAAGACGG + Intergenic
1083741780 11:64715026-64715048 AGGGAAAGACTGAAGGAAGAGGG + Intronic
1084327718 11:68411414-68411436 GCTGGAAGGCACAAGGGAGAAGG - Exonic
1085069859 11:73534224-73534246 ACTGAAAGCTAGAAAGCAGATGG + Intronic
1085202099 11:74708062-74708084 AGGGAAAGGCAGAGTGAAGAAGG - Intronic
1085213123 11:74800847-74800869 GCTGAAAGGCTGAATGAAGAGGG - Intronic
1085247098 11:75111118-75111140 TATGAAAGGGAGAAAGAAGAAGG + Intronic
1085335415 11:75690046-75690068 AGTAGAAGGAAGAAGGAAGAAGG - Intergenic
1086203780 11:84234346-84234368 ACTGATGGGCAGAAGGCAGAAGG - Intronic
1086282859 11:85210845-85210867 AATGGAAGGGAGAAGGAAGAAGG - Intronic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1087650702 11:100863631-100863653 ACTGAAGGACAGAAGGAAATGGG + Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087859259 11:103133291-103133313 ACGGAAAGGAAGAATGAAGAAGG - Intronic
1087878936 11:103392214-103392236 ACTGCAAGGCAGCAGGAGGCTGG - Intronic
1088277358 11:108101884-108101906 TCAGAGAGGAAGAAGGAAGAAGG - Intronic
1088582363 11:111328360-111328382 TCAGAAAGGCAGAAGTAAAAGGG - Intergenic
1089200130 11:116719665-116719687 ACAGAAAGGCAGGTGGATGAAGG + Intergenic
1089305804 11:117525356-117525378 ACAGAGAGACAGATGGAAGAAGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090485563 11:127109161-127109183 AGAGAAAGGCAGAAGGAGAAAGG - Intergenic
1091296675 11:134478566-134478588 ATACACAGGCAGAAGGAAGAAGG - Intergenic
1091321218 11:134653350-134653372 ACTGAAAGGTAGAAAGAGCAAGG - Intergenic
1091441061 12:512027-512049 GGTGGAAGGCAGAAGGTAGAAGG - Intronic
1091441177 12:512496-512518 GGTGGAAGGCAGAAGGTAGAAGG - Intronic
1091659635 12:2373748-2373770 ATGGAAAGGCAAAAGGAAAATGG - Intronic
1091714113 12:2764807-2764829 GCTAAAGAGCAGAAGGAAGAAGG + Intergenic
1092065213 12:5584357-5584379 ACTGAATGTCAGAAGGAAGCTGG - Intronic
1092548022 12:9468466-9468488 GCTAAAGGGCAGAAGGAAAAAGG + Intergenic
1093007282 12:14064292-14064314 ACTGGACGGCAGGTGGAAGAGGG + Intergenic
1093206048 12:16251302-16251324 ACACAAAGTCAGAAGAAAGAAGG + Intronic
1093508391 12:19896724-19896746 GGAGAAAGGAAGAAGGAAGAAGG - Intergenic
1094504979 12:31053982-31054004 GCTAAAGGGCAGAAGGAAAAAGG - Intergenic
1095212866 12:39513589-39513611 AAAGAAAGAGAGAAGGAAGAAGG + Intergenic
1095359140 12:41314579-41314601 TCCAAAAGGAAGAAGGAAGAGGG + Intronic
1095360632 12:41334234-41334256 AATGAAAGGCAGAAGCAAGAAGG - Intronic
1095475280 12:42580906-42580928 ACGGAAGGACGGAAGGAAGAAGG + Intronic
1095903254 12:47350649-47350671 ACTGAAAGGCTGGGGAAAGAGGG - Intergenic
1095936133 12:47683781-47683803 ACTGAAAATCAGAAGGAATCAGG - Intronic
1096131000 12:49158920-49158942 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1096546796 12:52345657-52345679 TCTCACAGGCAGGAGGAAGAGGG + Intergenic
1096694203 12:53338515-53338537 ACTGAAGGGGAAAAGGAGGAAGG + Intronic
1097134149 12:56837348-56837370 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
1097346481 12:58498956-58498978 ACTGAAAGGCGGAAGTGAGATGG - Intergenic
1097493772 12:60301870-60301892 ACTGAGAGGCATGAGGCAGAAGG - Intergenic
1097533748 12:60839108-60839130 TCTGCATGGCAGAAGGCAGAAGG + Intergenic
1097751996 12:63365834-63365856 CCTGAAAGGCAGCAGGAAACAGG - Intergenic
1097931567 12:65193168-65193190 ACTGAGAGGCATAAGGCAGAAGG + Intronic
1097940257 12:65296886-65296908 AGTGATAGGGAGAAGGAAGTGGG + Intronic
1098458123 12:70699842-70699864 ACAGAAGGTGAGAAGGAAGAAGG - Intronic
1098694797 12:73538772-73538794 ACTGAAAGAGACAAGGAAAATGG + Intergenic
1099694628 12:86002120-86002142 ACTGAAGGGCTGAAGCAGGAAGG - Intronic
1100466190 12:94848035-94848057 AAGCAAAGGCAGAAGGAAAATGG - Intergenic
1100680198 12:96910312-96910334 ACTTGAAGGCAGAAGCAAGTTGG + Intronic
1101031389 12:100663996-100664018 ATTCATAGGCAGAAGAAAGATGG + Intergenic
1101279593 12:103238794-103238816 CCTGAAAGACTAAAGGAAGAGGG + Intronic
1101407256 12:104439447-104439469 ACTAAGGGGCAGAAGGCAGAAGG - Intergenic
1101528102 12:105549909-105549931 AGTGAATGGGAGAAGGAAGAAGG - Intergenic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101755022 12:107614586-107614608 TCTGCTAGGTAGAAGGAAGAAGG + Intronic
1101835862 12:108295071-108295093 ACTGGAATGCAGAGAGAAGATGG + Intronic
1102904929 12:116667187-116667209 ACTGACAAGCTGAAGGTAGAAGG + Intergenic
1103194325 12:119029007-119029029 ACAGAAAGGGACAACGAAGAAGG + Intronic
1103781799 12:123403603-123403625 ATTGAAAGTGGGAAGGAAGAAGG + Exonic
1104094286 12:125542495-125542517 ACTGAAAGGAAAGAGGAATAGGG - Intronic
1104186315 12:126435471-126435493 ATTGAAAAGCAAAAGAAAGAAGG - Intergenic
1104575402 12:129962156-129962178 ACCGAAAGAAAGAAGAAAGAAGG - Intergenic
1104634352 12:130428222-130428244 TCTGAAATGCAGCTGGAAGATGG - Exonic
1104960225 12:132485061-132485083 AGTGGAATGCAGAAGGCAGAGGG - Intergenic
1105217613 13:18298302-18298324 ATTGAAAGTGGGAAGGAAGAAGG + Intergenic
1105284385 13:18992753-18992775 ACAGAAGGACAGAAGGCAGAAGG + Intergenic
1105284577 13:18993821-18993843 CCTGAAGGCCAGAAGTAAGAAGG + Intergenic
1105554156 13:21429871-21429893 ACTGAACAGCAGAATGGAGAGGG - Intronic
1106024025 13:25940449-25940471 ACGGGAAGGCAGCAGGAAGCGGG - Intronic
1106050023 13:26181070-26181092 ACTGGAAGGCTGATGGAGGAAGG - Intronic
1106673810 13:31935684-31935706 AATGGAAGGCAGAAGCAAAAAGG + Intergenic
1106749332 13:32743609-32743631 ATGGAAAGGCAGAAGGCAGCTGG - Intronic
1107203626 13:37753863-37753885 GCTGAAAGACAGAAGAGAGAGGG - Intronic
1107258998 13:38468119-38468141 TCTGAAAGGTAGAGAGAAGATGG - Intergenic
1107269960 13:38603657-38603679 ACTGAAAAGTAGAAGGAAAGAGG + Intergenic
1107695358 13:42994300-42994322 ACTGGAAGGCAGCAGAGAGAAGG + Intergenic
1107789247 13:43984550-43984572 AAACAAAGGAAGAAGGAAGAGGG + Intergenic
1108353074 13:49604950-49604972 ACTGAGGGGCATAAGGCAGAGGG - Intergenic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1108569424 13:51734822-51734844 ACTGAAAGGGACCAGAAAGATGG + Intronic
1108696833 13:52909602-52909624 AGTGGAGGGCAGGAGGAAGATGG + Intergenic
1108702141 13:52952823-52952845 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1109156228 13:58913465-58913487 TCTGAAAGGTAGAAAGAAGAAGG + Intergenic
1109216694 13:59597644-59597666 ACTGAAAGGTGGAGAGAAGAGGG + Intergenic
1109390006 13:61681189-61681211 ACTGGAAAGCAGAAGGAAATGGG + Intergenic
1109392925 13:61716764-61716786 ACTGTATGGGAGAGGGAAGAAGG - Intergenic
1109821627 13:67664629-67664651 CCTGAAGGGCAGAGAGAAGAGGG + Intergenic
1109858091 13:68159898-68159920 ACTAAAGGGCAGAAAGAATATGG + Intergenic
1110036399 13:70690797-70690819 ACTCAGTAGCAGAAGGAAGAGGG - Intergenic
1110109187 13:71722166-71722188 AAGGAAAGCCAAAAGGAAGATGG - Intronic
1110408919 13:75183061-75183083 TCTGAAAGGTAGTAAGAAGAAGG + Intergenic
1110609582 13:77474171-77474193 ACTGAGAGGCATAAGGCAAAAGG + Intergenic
1110752906 13:79136669-79136691 AGTGAAAGGAAGGAAGAAGAAGG + Intergenic
1111096634 13:83524006-83524028 TCAGGAAGGCAGAAGGCAGAAGG - Intergenic
1111225138 13:85260934-85260956 TCTTAAAGGGAGAAGGAAGAGGG + Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1111880864 13:93955191-93955213 AGTGAAGTGCAGAAGGAAGTTGG + Intronic
1112022727 13:95385596-95385618 CCTGAAGGTCAGAAGCAAGATGG - Intergenic
1112335306 13:98510310-98510332 ACTGAAAGGCAGCTGGATGTGGG - Intronic
1112845578 13:103638849-103638871 TTTGAAAGACAGAAGGAAAATGG - Intergenic
1113277395 13:108746328-108746350 ACTGAAATGCAAAAAGAACAAGG + Intronic
1113355556 13:109576580-109576602 ACAGAAAGGGAGGAGGTAGAAGG + Intergenic
1113370471 13:109720437-109720459 TCAGAAATGCAGAAGAAAGAAGG + Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113883158 13:113640098-113640120 ACTGCAAGGCAGGAGGCGGATGG - Exonic
1114422073 14:22592684-22592706 ACTGAAAGGATGAAGGGATATGG - Intergenic
1114453114 14:22839070-22839092 ACAGAACGACAGAAGGAAGACGG - Intronic
1114453118 14:22839100-22839122 GCAGAACGACAGAAGGAAGATGG - Intronic
1114870366 14:26648347-26648369 AAGTAAAGGCAGGAGGAAGAAGG + Intergenic
1115418830 14:33168753-33168775 CGTGAATGGCAGAAGGAAGAGGG - Intronic
1115620118 14:35132837-35132859 AAGGGAAGGAAGAAGGAAGAAGG + Intronic
1115704746 14:35987549-35987571 CCTGAAGGTCAGAAGCAAGATGG - Intergenic
1115834162 14:37378708-37378730 AAGGAAAGGAAGAAGGGAGAGGG + Intronic
1116341259 14:43726157-43726179 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1116663797 14:47748719-47748741 ACTGAGATGGAGGAGGAAGAAGG - Intergenic
1116708583 14:48335564-48335586 ACTGAGGGGCAGAAGGATAAAGG - Intergenic
1116822451 14:49638661-49638683 ACTGAATGGCAGCAGGGTGAGGG - Intergenic
1116826397 14:49677307-49677329 AGAGAAAGGCCGAAGGACGATGG + Intronic
1117178364 14:53168355-53168377 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1117223643 14:53633125-53633147 ACTGAAAGGGCAAAGAAAGAAGG + Intergenic
1117431963 14:55675883-55675905 AATGAAAGACAGAAGGTAGCTGG + Exonic
1117512395 14:56466143-56466165 ACTGAAAGGCTGAAGGGACTGGG - Intergenic
1117579152 14:57134354-57134376 AGTGAAAGGTGGAAGGGAGAAGG + Intergenic
1117732981 14:58742682-58742704 ACTGTAAGGCATGAGGAAAAAGG + Intergenic
1118680085 14:68232005-68232027 AGTGAAAGAAAGAAGAAAGAGGG + Intronic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1118824227 14:69366015-69366037 ACGGAAAGTCACTAGGAAGATGG + Intergenic
1118911610 14:70066484-70066506 TCTTAAAGGCAGAAGGAAGGGGG - Intronic
1118963271 14:70555795-70555817 TTTGAAAGGGAGAAGTAAGAGGG - Intergenic
1119230522 14:72975763-72975785 AGTGAAAGGAAGGAGGAAGAGGG + Intronic
1119489532 14:75018984-75019006 AATGAAAGACAGAAACAAGAAGG + Intronic
1119533410 14:75379751-75379773 ACCTAATGGCAGAAGGCAGAAGG - Intergenic
1119535812 14:75401637-75401659 ACGGAAAGGCAGAAGAACGATGG + Intergenic
1120020529 14:79525059-79525081 ACAGAAAGGCAGAGGGAAATTGG + Intronic
1120940790 14:89947110-89947132 AGTGCAAAGGAGAAGGAAGATGG + Intronic
1120969999 14:90199269-90199291 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1121004279 14:90478459-90478481 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1121658045 14:95612767-95612789 AATGGAAGGAAGAAGAAAGAAGG + Intergenic
1121878400 14:97476533-97476555 ACTAAAAAGCAGAAAGAAGAAGG - Intergenic
1122053715 14:99078089-99078111 ACTGAAAGGCAGAGAGGTGAAGG - Intergenic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1122282851 14:100634462-100634484 ACTGAACGGCAGAGGCAGGATGG - Intergenic
1122534409 14:102452210-102452232 ACTTTAAGGTAGAAGGCAGAGGG - Intronic
1122580579 14:102769162-102769184 ACTGGAAGGAAGAGGGGAGAAGG + Intergenic
1123431008 15:20216330-20216352 ACTGAGGGGCAGAAGGCAGAAGG - Intergenic
1123941898 15:25220802-25220824 ACTGAAGGACACAGGGAAGAAGG - Intergenic
1123945789 15:25238292-25238314 ACTGAAAGACACAGGGAAGAAGG - Intergenic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124832330 15:33161330-33161352 ATTGGAGGGCAGATGGAAGAGGG + Intronic
1125041137 15:35188613-35188635 ACTGAGGGACAGAAGGCAGAAGG - Intergenic
1125425276 15:39542592-39542614 AGAGGAAGGCAGAAGGGAGAGGG - Intergenic
1125581218 15:40787408-40787430 ACTGAGGAGCAGAAGGAAGTAGG + Intronic
1126049208 15:44671561-44671583 AAATAAAGGCAGAAGGAAGCAGG + Intronic
1126297693 15:47159435-47159457 ATTGAAAGGCAGAAAGAAAAAGG + Intergenic
1126322556 15:47440992-47441014 TTTCAAAGGCAAAAGGAAGAAGG - Intronic
1127913339 15:63436211-63436233 ACTGAGAGACATAAGGCAGAAGG - Intergenic
1128158990 15:65410788-65410810 AAAGAAAAGCAGAAGGAACAGGG + Intronic
1128487025 15:68102826-68102848 AATGGAAGGCAGCAGGCAGATGG - Intronic
1129166356 15:73780479-73780501 ACTTCCAGGCAGAAAGAAGATGG + Intergenic
1129201403 15:74003577-74003599 TCTGAAAGTGAGAAGGAAGAGGG - Intronic
1129464377 15:75715773-75715795 GTTGGAGGGCAGAAGGAAGAAGG - Intergenic
1129720868 15:77877239-77877261 GTTGGAGGGCAGAAGGAAGAAGG + Intergenic
1129814474 15:78540022-78540044 AGTGAAAGCCAGAATGAAAAAGG + Intergenic
1130307203 15:82721275-82721297 GTTGAAAGGCAGAAGGAAAAGGG - Intergenic
1130628612 15:85542113-85542135 ACTGTAAGGCAAAAGTTAGATGG + Intronic
1130712291 15:86294988-86295010 ACTGAAAGCAAGAGGGAGGAGGG - Intronic
1130862830 15:87906333-87906355 ACAGAAAGGCAGATGGGAGAAGG + Intronic
1131024776 15:89130975-89130997 AGTGAAGGACAGAAGGAAGGAGG - Intronic
1131052129 15:89355508-89355530 GCTTAAAGGCAGCTGGAAGATGG + Intergenic
1131090040 15:89617113-89617135 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
1131293620 15:91128650-91128672 ACAGAAAGGCAGAGGGAAGTGGG - Intronic
1131328697 15:91474326-91474348 ACAGAAAGGCAGAAGAAGGAAGG - Intergenic
1131747203 15:95461723-95461745 ATTGAAAGAAAGAAGAAAGAAGG + Intergenic
1131852118 15:96554605-96554627 AGAGAAAGAAAGAAGGAAGAAGG - Intergenic
1132060489 15:98688323-98688345 AGTGAAAGGCAGAGAGAGGAGGG - Intronic
1132090387 15:98943508-98943530 ACTGAAAGACAGACAGCAGATGG - Intronic
1132174226 15:99696442-99696464 ACAGAAAGGTAGTAGGAAAATGG + Intronic
1132282660 15:100633635-100633657 AAGGAAAGGAAGAAGGAAGGAGG + Intronic
1132324005 15:100951268-100951290 ACAGAAAGACAGATGGAAAATGG + Intronic
1132416606 15:101624784-101624806 ACTGAGAGGCAGAGAAAAGAAGG + Intronic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1132880181 16:2158675-2158697 GCTGCAGGGCAGAAGGAAGGAGG + Intronic
1133342933 16:5049039-5049061 AATGGAAACCAGAAGGAAGAAGG + Intronic
1133436807 16:5786837-5786859 TCTGAAAGGTAGAATGAAGCCGG + Intergenic
1133614393 16:7462605-7462627 ACGGAAAGGCAGAAGTTAGCAGG + Intronic
1134851764 16:17484579-17484601 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135247395 16:20868796-20868818 AAGAAAAGGCAGAAGAAAGAAGG + Intronic
1135300210 16:21320208-21320230 AATGAAAGGAAGAAAGAAAATGG + Intergenic
1135682730 16:24472125-24472147 ACTGCAAGGCTGGAGGAAAAAGG + Intergenic
1135788936 16:25375758-25375780 ACTGAAGGGCATAAAGCAGAAGG + Intergenic
1135899238 16:26441514-26441536 GCTGGAAGGCAGAAGGGAGATGG - Intergenic
1135939591 16:26809742-26809764 AATGCAAGGGAGAAGGAGGAAGG + Intergenic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136565055 16:31064799-31064821 ACTGAGCTGAAGAAGGAAGATGG - Exonic
1136853645 16:33634917-33634939 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1137302981 16:47171557-47171579 ACTCAAAGCCAGCAGGAGGATGG - Intronic
1137430614 16:48415343-48415365 ACTGGAAGGCAGATAGAGGATGG + Intronic
1137637006 16:49995701-49995723 TCTGAAAGACAGTAAGAAGAAGG + Intergenic
1137758767 16:50923828-50923850 AATGAAAGAGAGAAGGAAGGAGG + Intergenic
1137800877 16:51260920-51260942 ACTGAGGGAGAGAAGGAAGAAGG - Intergenic
1137911931 16:52386248-52386270 AATGAAAGGGAGGAGGAAGTGGG + Intergenic
1137970105 16:52976060-52976082 ACTAAAATGCAGAAGAAAAAAGG + Intergenic
1137971360 16:52988164-52988186 ACTGAGAGACAGAAGGAAACTGG - Intergenic
1138562691 16:57811383-57811405 AGAGAAAGGAAGAAGGAAGGAGG + Intronic
1139244593 16:65429130-65429152 AGTGAGATGCTGAAGGAAGAAGG + Intergenic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140128056 16:72134209-72134231 ACTGAGGGGCAGAAGGCAGAAGG - Intronic
1140151761 16:72374610-72374632 ACTGAATGGCAGAAGACAGAAGG + Intergenic
1140170446 16:72598860-72598882 ACTGAGTGGGAGGAGGAAGAGGG + Intergenic
1140282970 16:73572496-73572518 ACAGAAAGGCAGGAAGGAGAAGG + Intergenic
1140692010 16:77493574-77493596 TCTGAGTGGCAGGAGGAAGATGG - Intergenic
1140852473 16:78947990-78948012 AGTCAAAGGCAGAGGGAGGAAGG + Intronic
1140965733 16:79964278-79964300 AAAGAAAGGAAGAAGAAAGAAGG - Intergenic
1142453233 16:90197294-90197316 TGTGAAAGACAGAAGAAAGAGGG - Intergenic
1203115236 16_KI270728v1_random:1483362-1483384 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1142497042 17:311410-311432 TCTGAAAGGCTGAGGGCAGAGGG - Intronic
1143071508 17:4298878-4298900 ATTGAAAGGAAGAAGCATGAGGG + Intronic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143563880 17:7709930-7709952 AGTGAGAGGCAGAAAGAAGGCGG - Exonic
1143846719 17:9777727-9777749 TATGGAAGGAAGAAGGAAGAAGG + Intronic
1144426903 17:15151711-15151733 TCTGAAATGGAGAGGGAAGAGGG - Intergenic
1144683821 17:17213419-17213441 AATGAAAGGCGGAGGGATGATGG - Exonic
1144834198 17:18148412-18148434 CCTGAAAGGAAGAAGCAAGCAGG + Intronic
1145090124 17:19979073-19979095 AGTGCAAGGAAGAACGAAGAAGG + Intergenic
1145102759 17:20090344-20090366 AATGAAAGGGAGAAGCAAAACGG - Intronic
1145243139 17:21251322-21251344 ACTCAGAGACAGAAAGAAGAGGG - Intronic
1145735991 17:27232028-27232050 ACTGTAGGGCAGAAGGAAATGGG + Intergenic
1146370525 17:32263266-32263288 AATAAAAGGGAGAGGGAAGATGG - Intergenic
1146796818 17:35787456-35787478 ACTGAAGGACAAAAGAAAGAAGG - Intronic
1146912947 17:36659790-36659812 AGTCAAAGGCAGACGGAAGAGGG + Intergenic
1147045321 17:37746941-37746963 GCTGAGAGCCAGAAGGAAGCGGG + Intergenic
1147530169 17:41268952-41268974 AATGAGAGGAAGAAGAAAGATGG + Intergenic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1147615635 17:41825666-41825688 AATGAGAGGCAGAAGCCAGAGGG + Intronic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1148805449 17:50261537-50261559 ACTGATGGGCAGAAGGATGGGGG + Intergenic
1148814083 17:50314191-50314213 AAGGAAGGGAAGAAGGAAGAGGG + Intergenic
1148869416 17:50647446-50647468 TCTGAGAGGCAGCAGGAAGTAGG + Intronic
1149054397 17:52345599-52345621 AAAGAAAGGAAGAAGGAAGAGGG - Intergenic
1149075402 17:52591916-52591938 ACTAAAAGGAAGATGGAAGGAGG - Intergenic
1149220076 17:54406901-54406923 ACAGAAATGATGAAGGAAGAAGG - Intergenic
1149500750 17:57150508-57150530 ACTGAAGGACATAAGAAAGAAGG + Intergenic
1150426340 17:65079932-65079954 ACAGAAATACAGAAGGAAGGTGG - Intergenic
1150827892 17:68492734-68492756 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1150974705 17:70071890-70071912 AATCAGAGGCAGAAGGAAAAGGG - Intronic
1151078481 17:71301438-71301460 ACAGAAAGAAAGAAAGAAGAAGG - Intergenic
1151183340 17:72345533-72345555 CCAGGAAGGCAGAAAGAAGAGGG + Intergenic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151594051 17:75066052-75066074 AATGAAAGGGAGGAGGGAGAAGG - Intergenic
1151810532 17:76438099-76438121 ACCAAAAGGCAGTAAGAAGAGGG - Intronic
1152443421 17:80324749-80324771 ACTGGCAGCCAGAAGGAAGGAGG + Intronic
1152498064 17:80688555-80688577 GCTCAAAGGGAGAAAGAAGAAGG + Intronic
1152523084 17:80871852-80871874 ACTGACAGTCAGCTGGAAGATGG - Intronic
1152984609 18:310521-310543 ACTGAAGGTCAGAAGGATGTGGG - Intergenic
1153761134 18:8333822-8333844 ACTGAATGGCAGAAGTGCGAAGG - Intronic
1154113021 18:11586491-11586513 ACTGAAGGGCATAAGGCAGAGGG - Intergenic
1155108631 18:22691759-22691781 AATGAAAGGCAAATGGAAGGGGG - Intergenic
1155506780 18:26541160-26541182 GCTGCAGGGCAGCAGGAAGATGG - Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155680998 18:28485660-28485682 ACTAGAAGGCAGAATAAAGAAGG + Intergenic
1155692587 18:28644080-28644102 AAAGAAAGGAAGAAAGAAGAAGG + Intergenic
1155868327 18:30994242-30994264 AGTGAAAAGCAGGAAGAAGATGG - Exonic
1155882174 18:31162940-31162962 ACACATAGGCAGAAGGAGGAGGG + Intergenic
1156083868 18:33375883-33375905 ACTGAGAAGCATAAGGCAGAAGG + Intronic
1156347225 18:36268818-36268840 AGTCAAAGGCAGAAGGAAGCAGG - Exonic
1156931149 18:42645154-42645176 ACTCAAAGGCAGATAGGAGAGGG - Intergenic
1157015955 18:43713052-43713074 TCTTCAAGGAAGAAGGAAGAAGG + Intergenic
1157167849 18:45374818-45374840 ACTGCAAAGCAGAAGGATTAGGG + Intronic
1157300476 18:46475240-46475262 ACCAAAAGGCAGGAGGAGGAGGG + Intergenic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157841371 18:50962165-50962187 AATGAAAGCCAGAAGGCAGTGGG - Intergenic
1158660409 18:59382188-59382210 ACAGAAACACAGAAGGAAGATGG - Intergenic
1158789159 18:60754762-60754784 ACTCAAAGGCAGACAGAAGAGGG - Intergenic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1159239151 18:65718645-65718667 ACTGAAAGCTAGAAGAAGGAAGG + Intergenic
1159539947 18:69761935-69761957 ACTGAGGGGCATAAGGCAGAAGG + Intronic
1159842611 18:73417022-73417044 TCTGAAAGGTAGAAACAAGAAGG + Intergenic
1159872134 18:73770243-73770265 GCTGGAAGACAGGAGGAAGATGG + Intergenic
1159964064 18:74579170-74579192 AAGGAAAGGGAGAAGGGAGAAGG - Intronic
1160003206 18:75047407-75047429 GCAGAAGGGCAGAAGGCAGAGGG - Intronic
1160388154 18:78510380-78510402 ACTTAAAGGCAAAGGGAGGAAGG + Intergenic
1160465657 18:79073672-79073694 ACGGAGAGGGAGAAGGGAGAGGG + Intronic
1161521247 19:4724532-4724554 TCTAAAAGGCAGGAGGAAGGCGG + Intronic
1161673089 19:5625065-5625087 AATGAAAAGGAGAAGGAAGAAGG - Intronic
1162155920 19:8677891-8677913 ATGGAAAGGAGGAAGGAAGAGGG - Intergenic
1162164954 19:8745997-8746019 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162166025 19:8753461-8753483 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162167091 19:8760917-8760939 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162169100 19:8774673-8774695 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1163013326 19:14439122-14439144 ACTGAGAGGAAGCAGGAAGTTGG + Intronic
1163176746 19:15569551-15569573 GATGAGAGGCAGAAGAAAGAGGG + Intergenic
1163235388 19:16026797-16026819 ACTGGAAGGAAGAAGGGAGCAGG - Intergenic
1163810278 19:19427092-19427114 TCTTAAAGACAGAAGGAAGAAGG + Intronic
1163996340 19:21051388-21051410 ACTGAAAGCCAGTAGGTAAAAGG - Intronic
1164086958 19:21911725-21911747 ACTTAGAGGCATAAGGCAGAAGG + Intergenic
1164180076 19:22810604-22810626 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1164398454 19:27886577-27886599 AGGGAAAGGCAAAAGGCAGATGG + Intergenic
1164473314 19:28553949-28553971 ACTGCAAGACAGAAGGAACTTGG - Intergenic
1164574705 19:29398967-29398989 AAGGAAAGGAAGAAGAAAGAAGG + Intergenic
1164649906 19:29884233-29884255 AAGGAAAGGAAGAAGGAAGAAGG - Intergenic
1165322645 19:35095813-35095835 AAAGAAAGGAAGAAGGAAGAAGG + Intergenic
1165942206 19:39420604-39420626 CCTGAAAGACAGGAGGATGAGGG - Exonic
1166202274 19:41245760-41245782 ACTGAAATCCAGAAAGAAAATGG + Intronic
1167222973 19:48215150-48215172 ACTGAGGGGCATAAGGCAGAAGG - Intronic
1167635931 19:50655769-50655791 CCTGCAAGGCAGGAGGAAGCAGG - Intronic
1167727522 19:51226202-51226224 ACAGAAATGCAGAAGGGACAGGG - Intronic
1168543521 19:57231720-57231742 ACTGAAAGAGAGGAGGAGGAGGG - Exonic
925234902 2:2269537-2269559 AATGCAAGGCAGAAGTAGGATGG - Intronic
925296922 2:2783446-2783468 TCTGAAAGCCAGAAGCCAGAAGG + Intergenic
925645014 2:6027040-6027062 ACAGAAAGGCAGAAAGAGAAAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925751619 2:7094858-7094880 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
926169460 2:10542950-10542972 ACAGAGAGCCAGAAGGAAGAAGG - Intergenic
926407090 2:12565789-12565811 AGTGAAAGGGGGAAGGCAGATGG - Intergenic
926439572 2:12874118-12874140 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
926837211 2:17036279-17036301 AATGATAGGCAGATAGAAGAAGG + Intergenic
927037545 2:19194890-19194912 ACCGAATGCCAGAAGGAAGGTGG - Intergenic
927278038 2:21278488-21278510 ATAGAAAGGCAGAAAGCAGAAGG - Intergenic
927551924 2:24008972-24008994 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
927624078 2:24694685-24694707 ACTCAAAAACAGAATGAAGAAGG - Intronic
927877330 2:26666998-26667020 AAGGAAAGAGAGAAGGAAGAAGG - Intergenic
927937049 2:27082052-27082074 AGGGGAAGGCAGAAGGCAGAGGG - Intronic
927956723 2:27212146-27212168 ACTAAAGGGGAAAAGGAAGAGGG + Exonic
928284660 2:29979345-29979367 ACAGAAAAGCACAAGGGAGAAGG + Intergenic
928654900 2:33440395-33440417 AATGAGAGGCAGATGGAAAATGG + Intronic
928854274 2:35785368-35785390 AATGCAAGTTAGAAGGAAGAAGG - Intergenic
928854940 2:35791676-35791698 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
929611411 2:43273527-43273549 ACTGGAAGGCAGGAGGAAGGGGG + Intronic
929763611 2:44826205-44826227 TCTGGAGGGCAGAAGGTAGAAGG - Intergenic
929811582 2:45193368-45193390 AAAGGAAGGCAGAAGGAAGCAGG + Intergenic
929828520 2:45329153-45329175 AGGGAAAGGGAGAAAGAAGAGGG + Intergenic
930011982 2:46944309-46944331 ACTGAAATGTGGAAGGAAAAGGG - Intronic
930224100 2:48774656-48774678 AAGGAAAGGAAGAAGAAAGAAGG - Intronic
930365825 2:50438171-50438193 ACTGGAAGTCAGAAAGGAGAAGG - Intronic
930591049 2:53326750-53326772 ACTGAGGGGCACAAGGCAGAAGG - Intergenic
930648994 2:53945483-53945505 ACAGAAAGCTAGAAGGAGGAAGG + Intronic
930946939 2:57085766-57085788 ACTGATGGGCATAAGGCAGAAGG + Intergenic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931020420 2:58038446-58038468 ACTGTAAGGCAGAAAGGAGGAGG - Intronic
931027861 2:58134240-58134262 TCTTAAAGGGAGAAGGGAGAGGG - Intronic
931051574 2:58421135-58421157 GATGGAAGGAAGAAGGAAGAAGG + Intergenic
931260659 2:60615544-60615566 ATTGAGAGTGAGAAGGAAGATGG + Intergenic
931467850 2:62507096-62507118 ACTGAAAGGAAATAGGAAGGGGG - Intronic
932089503 2:68792413-68792435 ACAGAAACTCAGAAGGATGAGGG - Intronic
932180437 2:69642228-69642250 ACCTAAAGCGAGAAGGAAGAGGG + Intronic
932398534 2:71464412-71464434 CCTGAAAGGGAGATGAAAGAGGG + Intronic
933295284 2:80483228-80483250 AATGAAAGAAAGAAGGGAGAGGG - Intronic
933481358 2:82861128-82861150 AATGGAAGTGAGAAGGAAGAGGG - Intergenic
933495203 2:83041447-83041469 ACAGAAAGGGAGAAAGATGATGG + Intergenic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
933569725 2:83995427-83995449 AAGGAAAGGAAAAAGGAAGAAGG - Intergenic
933748237 2:85585843-85585865 AGTGAAAGGAAGAAGGACCAGGG - Intronic
933998168 2:87685169-87685191 ATAGGAAAGCAGAAGGAAGAAGG + Intergenic
934165908 2:89294119-89294141 TCAGAAAAGCAGGAGGAAGAGGG + Intergenic
934201369 2:89888337-89888359 TCAGAAAAGCAGGAGGAAGAGGG - Intergenic
934296695 2:91748349-91748371 ATTGAAAGTGGGAAGGAAGAAGG - Intergenic
934676064 2:96250423-96250445 ACAGAAAGGCAGAGTGAAGTGGG - Exonic
934885467 2:98020807-98020829 ACAGACACGCAGAAAGAAGATGG - Intergenic
935024299 2:99261546-99261568 AATCAAGGGCAGAAGGATGAGGG + Intronic
935095631 2:99941708-99941730 CCTGATAGGAAGGAGGAAGAAGG - Intronic
935171456 2:100613886-100613908 AAAGGAAGGAAGAAGGAAGAAGG - Intergenic
935299966 2:101685619-101685641 ACTGAGCGGCATAAGGCAGAAGG + Intergenic
935325150 2:101929060-101929082 ACTGAGGGGAAGAAGTAAGAAGG + Intergenic
935377150 2:102411201-102411223 ACTGGACAGCAGCAGGAAGAAGG - Intergenic
935624225 2:105156015-105156037 TCTGAAAAGGGGAAGGAAGAAGG + Intergenic
935938261 2:108209825-108209847 AGTGCCAGGAAGAAGGAAGAAGG - Intergenic
935976876 2:108586902-108586924 AGTGGAAGGCAGATGGAAGCTGG - Intronic
936261711 2:110965764-110965786 CCTGGAAGGGGGAAGGAAGAAGG + Intronic
936295684 2:111265704-111265726 ATAGGAAAGCAGAAGGAAGAAGG - Intergenic
936980636 2:118262149-118262171 ACTTTAAGGCAGAAGGCACATGG - Intergenic
936984704 2:118297877-118297899 ACGAAGAGGTAGAAGGAAGAAGG - Intergenic
937198285 2:120179869-120179891 ACTGACAGGAAGATGGAGGATGG + Intergenic
937535108 2:122876677-122876699 CCTGAAAGGAAGAAAGCAGAGGG - Intergenic
937615835 2:123921358-123921380 AAGGAAAGAAAGAAGGAAGAAGG + Intergenic
937768055 2:125685021-125685043 TCTAAAAGGTAGAAAGAAGAAGG + Intergenic
938062029 2:128261873-128261895 AGTGAAAGGCAGCAGGGAGCAGG + Intronic
938249998 2:129807185-129807207 GCTGAAAATCAGAAGGAAGTGGG - Intergenic
938328280 2:130428724-130428746 ACGGAAAGGCAGCGGGAAGGAGG - Intergenic
938361667 2:130692770-130692792 ACGGAAAGGCAGCGGGAAGGAGG + Intergenic
938695606 2:133832722-133832744 TATGTAAGGCAGAAGCAAGATGG - Intergenic
938781529 2:134589109-134589131 AGTGAGAGGCAGCAGAAAGAAGG + Intronic
939001426 2:136740013-136740035 TCTGAAAGGAAGGAGGAAAATGG + Intergenic
939532148 2:143376731-143376753 ACAGAAAGCCAGAAGAAAGTGGG - Intronic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
939858474 2:147389558-147389580 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940358040 2:152767029-152767051 AGTGGAAGCCAGAAGGAATATGG + Intergenic
940662765 2:156568107-156568129 CCTTAAACTCAGAAGGAAGAAGG + Intronic
940840281 2:158571917-158571939 TCTGAAAGCCAGAAGGAAGATGG + Intronic
940853905 2:158714964-158714986 TCTGAAAGGTAGAGGGAAGAAGG - Intergenic
940868438 2:158839468-158839490 ACTGAGGGGCATAAGGTAGAGGG - Intronic
941536640 2:166730425-166730447 ACTGAGAGGAAGAAGGCAGAAGG + Intergenic
941576109 2:167232388-167232410 ACTCAAAGAGAGAAGGAAAAAGG - Intronic
941915922 2:170813916-170813938 GCTCAAAGGCAGAAGAAGGAGGG - Intronic
942064714 2:172259864-172259886 TCTGAAAGGTAAAAGGCAGAAGG + Intergenic
942243357 2:173984434-173984456 ACTGTAAGATAGAAAGAAGATGG - Intergenic
942260363 2:174154960-174154982 TTTGAAAGGCAGAAGTAAGAAGG - Intronic
942588622 2:177515468-177515490 ACTTGGGGGCAGAAGGAAGAAGG - Intronic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943519099 2:188925270-188925292 ACTTTATGGCAGAAGGAAAAGGG - Intergenic
943721654 2:191209450-191209472 ACTTAAAGGAATGAGGAAGATGG - Intergenic
943901378 2:193442075-193442097 GGAGAAAGGCAGAAGGAAGCTGG - Intergenic
943903020 2:193465449-193465471 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
944058617 2:195548305-195548327 AAGGAAAGGAAGAAGGAAGAGGG + Intergenic
944240099 2:197478004-197478026 ACTGAGAGGCAGAAGAAAGGTGG + Intergenic
944586168 2:201175750-201175772 ACTGAGGGGCATAAGGCAGAAGG + Exonic
944691695 2:202164495-202164517 ACTCAAGGAAAGAAGGAAGAAGG + Intronic
945583243 2:211624044-211624066 ACTGCAAAGCGGAAAGAAGAAGG + Exonic
945963133 2:216156880-216156902 ACTGGAAGGAAAATGGAAGAAGG + Intronic
945968149 2:216210104-216210126 AGAGGAAAGCAGAAGGAAGATGG + Intergenic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946053884 2:216884839-216884861 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
946290986 2:218745467-218745489 ACTGAAAGGGAAAAGCAACAAGG - Intronic
946821932 2:223639061-223639083 TTTGAAAGGCAGAAGGATGCAGG - Intergenic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
947156887 2:227171729-227171751 ACTGAGGGGCAGAAGGCTGAAGG + Intronic
947751100 2:232532898-232532920 GCTGCAACTCAGAAGGAAGAAGG + Intronic
947869272 2:233423940-233423962 CCTGAAAGGTAGAGAGAAGATGG - Intronic
947941896 2:234064129-234064151 AATGAGGGGGAGAAGGAAGAGGG - Intronic
948062522 2:235052183-235052205 ACAGAGAGGCAGAGAGAAGAAGG - Intronic
948318762 2:237052309-237052331 TTTGACAGGCTGAAGGAAGAAGG + Intergenic
949084672 2:242141952-242141974 TGTGAAAGACAGAAGAAAGAGGG - Intergenic
1168751931 20:288679-288701 ACTGAAACACAGAAAGGAGATGG - Intronic
1168930009 20:1614064-1614086 ACTGAAGGCCAGAAGATAGAGGG + Intronic
1169009805 20:2241132-2241154 AATGAAAGGAAGAAGAAAAAAGG - Intergenic
1169229142 20:3875543-3875565 AGTGAAAGGCACAAGGGAGGTGG + Exonic
1169318592 20:4612715-4612737 AATGAACAGAAGAAGGAAGAGGG + Intergenic
1169469441 20:5871566-5871588 TCTGAATGGCAGAAAGAAGATGG + Intergenic
1169760657 20:9089385-9089407 ACTTAAAAGCACAAAGAAGAAGG + Intronic
1170359364 20:15527828-15527850 ACTGAAGGGGAGAAGAAAAAGGG - Intronic
1170485152 20:16807980-16808002 TCTGAGAGGAAGAGGGAAGAAGG + Intergenic
1170668829 20:18411116-18411138 ACTTAAAGTAAGAAGAAAGAAGG + Intronic
1170698947 20:18685858-18685880 ACTGCAGGGGAGAAGGAAGAGGG - Intronic
1170704187 20:18729869-18729891 ACTCAGAGAGAGAAGGAAGAAGG - Intronic
1170812376 20:19684563-19684585 GGTGAAAGGGAGAAGGAACAGGG - Intronic
1171049987 20:21848934-21848956 ACTCAGAGGCAGATGCAAGAAGG - Intergenic
1171140461 20:22736452-22736474 TCTGCAAGCCAGAAGGAAGTGGG + Intergenic
1172386976 20:34540876-34540898 ACTGAAGGTCAGAAGGAAGCTGG - Exonic
1172451807 20:35031112-35031134 AATGGAAGGCAGAAGGCAGTAGG - Intronic
1172829717 20:37823323-37823345 CCTGACTGGCTGAAGGAAGAAGG + Intronic
1172924058 20:38514292-38514314 TCTCAAAGGCAGGAGGAAAAAGG - Intronic
1172956147 20:38760772-38760794 ATTGAAAGGCAGTGGGTAGATGG + Intronic
1173010232 20:39175575-39175597 AGTGAAAGAAAGGAGGAAGAAGG - Intergenic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173301798 20:41810094-41810116 ACTGAAAAGTAGAAAGAAGAAGG + Intergenic
1175313579 20:58028834-58028856 ACTGGAATACAGAAGGAACAGGG - Intergenic
1175631005 20:60536385-60536407 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1175658073 20:60789377-60789399 GGTGAAAGGCAGAAGGTAGCTGG + Intergenic
1176018442 20:62950726-62950748 ACTGACAGGCAGCAGCAAGAGGG - Intergenic
1176281249 20:64314453-64314475 TGTGAAAGACAGAAGAAAGAGGG - Intergenic
1177255167 21:18652176-18652198 ACTGGAACCCAGAAGGCAGAGGG + Intergenic
1177547662 21:22579465-22579487 ACTGAGGGGCATAAGGAAGAAGG - Intergenic
1177665581 21:24153433-24153455 AGTGAAAGACATATGGAAGAAGG - Intergenic
1177866081 21:26514450-26514472 AGTGGAAGGCAGAAGGGAGCTGG - Intronic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178123086 21:29489249-29489271 AATGAGGGGCAGAAGGCAGAAGG - Intronic
1178235682 21:30838431-30838453 ACTGCCAGGCACAAGAAAGAAGG + Intergenic
1178288836 21:31349288-31349310 ACTGAAAGGGTGAAGGGAAAAGG + Intronic
1178373808 21:32050075-32050097 AATGACAGGCAGAAGGTAGACGG + Intergenic
1179162294 21:38908575-38908597 GCTGAGAGGCATAAGGCAGATGG - Intergenic
1179254821 21:39706504-39706526 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
1179362286 21:40722374-40722396 ACACAAAGGCAGGAGGAAGGAGG + Intronic
1179526348 21:41978923-41978945 ACTGGGAGGCTGAAGCAAGAGGG + Intergenic
1179611251 21:42552783-42552805 GCTGAAAAGCAGGAAGAAGAGGG + Intronic
1179899818 21:44384442-44384464 ACTGGAAGGCAGAAGGGTAAGGG + Intronic
1179954798 21:44732608-44732630 ATTAAAAGACAGAAGCAAGATGG + Intergenic
1179992815 21:44957477-44957499 ACTGCAAGGCACAGGGCAGATGG - Intronic
1180010564 21:45047752-45047774 AGTGAAAGGCAGAAAGTAGGTGG + Intergenic
1180928580 22:19573512-19573534 GCAGAAGGGCAGAAGGCAGAAGG + Intergenic
1181292019 22:21802468-21802490 ACTGGGAGGCAGCAGGAAGAAGG - Intronic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181425445 22:22834681-22834703 AATGAAGGGCAGGAGGTAGAAGG - Intronic
1181429689 22:22871552-22871574 AATGAAGGGCAGTAGGTAGAAGG - Intronic
1181440632 22:22933653-22933675 ACTGAAGGGCAGAGAGAGGACGG + Intergenic
1181921091 22:26320994-26321016 CCTGAAAGACAGAGAGAAGATGG + Intronic
1182376248 22:29850530-29850552 CTTGCATGGCAGAAGGAAGAAGG + Intergenic
1182653360 22:31870078-31870100 ACTGAAAGGTAGAAGAAAGGAGG + Intronic
1183079481 22:35447328-35447350 ACTCAAACCCAGAAGGAACAAGG - Intergenic
1183121008 22:35730206-35730228 ACAGAAAGGCAGAAAGAAGAGGG - Intergenic
1183305658 22:37081740-37081762 ACTGAAAGGCAGAAAAGACAGGG + Intronic
1184266736 22:43351276-43351298 ACTGCAGGACAGAAGGAGGATGG - Intergenic
1184653209 22:45928637-45928659 ATGGAAAGGCAGAAGGGAAATGG - Intronic
1184767707 22:46580190-46580212 AGTAACAGGCAGAAGGCAGAGGG + Intronic
1185178593 22:49346455-49346477 ACACAGAGGCAGGAGGAAGATGG + Intergenic
949119351 3:366911-366933 ATTGAAAAGTAGAAGGAAAATGG - Intronic
949261721 3:2109518-2109540 ACTGAAAGGCATAGGCAACATGG - Intronic
949396289 3:3617628-3617650 ACCGAGAGGCATAAGGGAGAGGG - Intergenic
949446023 3:4134581-4134603 ATTCAAAAGCAGAAGGCAGAAGG + Intronic
949614669 3:5739740-5739762 ACTCATAGGAACAAGGAAGAGGG - Intergenic
949676454 3:6459844-6459866 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
949781165 3:7690229-7690251 ACTTAAAGGCACAAAGACGAAGG - Intronic
949783720 3:7717946-7717968 ATTGTAAGGCAGAAGGGTGAAGG - Intronic
950513939 3:13451737-13451759 ACTGTAAGGCAGGAGGCAGCCGG + Intergenic
951548903 3:23857171-23857193 ACTGAAGGGCAGGAGAAAGCTGG + Intronic
952281864 3:31931149-31931171 ACCGAGAGACAGAAGGAAGGGGG + Intronic
952284342 3:31953727-31953749 ATTGAGAGGGAGAAGGAAAAGGG - Intronic
952355651 3:32581038-32581060 ACTGAAAAGAAGAAAGAAAAAGG + Intergenic
952675819 3:36029201-36029223 ACTGAAGGGCATAAGGCAGAAGG + Intergenic
952723091 3:36553937-36553959 GATGAAAGGCAGAAGGACAAAGG - Intergenic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
953523722 3:43669126-43669148 ACTGGAAGGCTGAAGCAAGCTGG + Intronic
953798938 3:46006627-46006649 ACTGAGGGGCATAAGGCAGAGGG - Intergenic
953927679 3:46990641-46990663 ACTGAAACTCAGAGGGCAGAAGG - Intronic
954167524 3:48772093-48772115 TCTGAAAGGTGGAAAGAAGAAGG - Intronic
954489255 3:50886147-50886169 TCTGAAAGGCGGAAAGAAGAAGG - Intronic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
954759945 3:52866743-52866765 ACTGACTAGCAGAAGGAAGTTGG + Intronic
954939538 3:54358801-54358823 ACTAAAAGTCAAAAGGTAGAGGG + Intronic
954952716 3:54489349-54489371 ACTGACAGGCAGAGGACAGAGGG - Intronic
955117601 3:56021274-56021296 TCTAGGAGGCAGAAGGAAGAAGG + Intronic
955289427 3:57677262-57677284 AGTGAAAGACAGCAGGAAGATGG + Intronic
955403996 3:58613807-58613829 ACTGATGGGCAGGAGGCAGAAGG + Intronic
955666559 3:61355425-61355447 ACTGAAAGGTAGAGAAAAGAAGG - Intergenic
955931988 3:64066592-64066614 ACTGAACTGCAGAATGGAGAAGG + Intergenic
955946908 3:64204210-64204232 ACTGAAAACCAGAAAGAAGCAGG + Intronic
956044177 3:65177545-65177567 ACTCAAAGGTAGGGGGAAGAAGG - Intergenic
956366569 3:68509846-68509868 CCTGAAAGGGAGAATGAAAAGGG + Intronic
956494994 3:69815402-69815424 GCTGAGGGGGAGAAGGAAGAGGG - Intronic
957130972 3:76222260-76222282 ACTGAGAGGCATAAGGTAGAAGG + Intronic
957164029 3:76647329-76647351 ACTGAAAGGCTAGAGGAGGAAGG - Intronic
957222598 3:77402951-77402973 ACTGAGGGGCATAAGGCAGAAGG - Intronic
957409928 3:79826802-79826824 ACAGAAAGGGAGAAGCAAGAGGG - Intergenic
957835128 3:85577449-85577471 GCTGCATGGCAGAAGGAGGAAGG - Intronic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958642299 3:96820591-96820613 ATTGCAAGGGATAAGGAAGATGG + Intronic
958656935 3:97014426-97014448 AAGGAAAGGAAGAAGGAAGGTGG - Intronic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
958810916 3:98859152-98859174 ACTGCAAGGCAGCAGGAGGCTGG + Intronic
958899899 3:99873470-99873492 ATTTAAAGGAAAAAGGAAGAGGG - Intronic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959887557 3:111520107-111520129 ACTTCAAGTCAGAAGGCAGAGGG + Intronic
959931672 3:111990972-111990994 ACTGAAAAGAAAAATGAAGAGGG - Intronic
960195861 3:114767493-114767515 ATTGAAAAGAAAAAGGAAGAAGG + Intronic
960322574 3:116254442-116254464 AGGGAAAGGAAGAAGGGAGAAGG + Intronic
960356812 3:116663814-116663836 ATAGAAATGCAGAGGGAAGAAGG + Intronic
960365920 3:116772234-116772256 GCTCAAGGGCAGCAGGAAGAAGG - Intronic
960709411 3:120512270-120512292 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
962043392 3:131731117-131731139 ACTGCATGGCAGGAGGATGAAGG - Intronic
962045576 3:131756545-131756567 AATGAATGGCAGAAGATAGATGG + Intronic
962707746 3:138061759-138061781 ACAGAAAGAGAGAAGGAAGCTGG - Intergenic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963458059 3:145572685-145572707 ACTGAGTGGCATAAGGCAGAAGG + Intergenic
963587358 3:147209250-147209272 AATCAAAGGGAGAAAGAAGAGGG - Intergenic
963778812 3:149466255-149466277 GCTGAAAGGAAGATGGATGAAGG + Intergenic
964249792 3:154699735-154699757 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
964710422 3:159665937-159665959 ACTGGAAGGCAGGAGGAGGAAGG - Intronic
964810598 3:160659717-160659739 ACTTCATGGCAGAAGGTAGAAGG - Intergenic
964928712 3:161988984-161989006 AGTGGAAGGCAGAAGGAATTAGG - Intergenic
965063714 3:163816057-163816079 ACTAAAAGGAAGAGGGAAGTGGG + Intergenic
965677183 3:171210176-171210198 ACGGAAGGACAGAAGGTAGAGGG + Intronic
965869047 3:173244668-173244690 ATTGAAATACAGAAGGAAAAAGG - Intergenic
966149256 3:176848709-176848731 TCTCAAGGGCAGAAGGAACAAGG + Intergenic
966169218 3:177059099-177059121 ACTAAAAGGCAGACTGAAGGCGG + Intronic
966275474 3:178160676-178160698 ACTGAAATGCAAAAAGAAAAAGG + Intergenic
966656201 3:182361243-182361265 AGTGAAAAGATGAAGGAAGAGGG - Intergenic
967340493 3:188391929-188391951 TTTGAAAGGCAAAAGTAAGATGG - Intronic
967394116 3:188987680-188987702 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
967462027 3:189758660-189758682 ACTGAGGGGCATAAGGCAGAGGG - Intronic
967598410 3:191355583-191355605 ACTGAAAGCCAGAAGGAAGAAGG - Intronic
967949196 3:194827768-194827790 AATGTAAGGCAGCAGGTAGAAGG - Intergenic
968086947 3:195878070-195878092 AGGGAAAGGCACTAGGAAGACGG + Intronic
968767577 4:2481608-2481630 ACAGAAAGGCAGAAGAGAGCAGG - Intronic
968951911 4:3699817-3699839 ACTGAGGGGCAGAGGCAAGAGGG + Intergenic
969343655 4:6557982-6558004 ACAGGAAGGCAGGAGGAAGGAGG + Intronic
969892167 4:10269947-10269969 AGTGCAAGGCTGAAGGCAGATGG + Intergenic
969971322 4:11051388-11051410 TCTGAAAGACAGATGGATGAAGG - Intergenic
970471104 4:16380055-16380077 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
970755950 4:19427374-19427396 TGTGAAAGGCAGAAGGAAGTAGG - Intergenic
971112356 4:23602552-23602574 AAGGAAAGGAAGAAGGAAGAAGG + Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971218095 4:24680609-24680631 AGAGAAAGGGAGAAGGAAGGAGG + Intergenic
971249426 4:24961165-24961187 GCTGAAGGACAGAAAGAAGAAGG + Intronic
971344141 4:25796938-25796960 AATGAAAGAAAGAAGAAAGAGGG + Intronic
971623496 4:28887411-28887433 ACTGGAAGTTAGAAGCAAGATGG + Intergenic
972241874 4:37202229-37202251 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
972613504 4:40676640-40676662 ACTTAACAGCAGACGGAAGATGG - Intergenic
972935287 4:44127192-44127214 ACCGAAGGGTAGAAGCAAGAAGG + Intergenic
973635477 4:52858324-52858346 TTTGAAAGGCAGAAGCAAGGAGG + Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974461084 4:62188746-62188768 ATTCAAAGGAAGAAGGAAAATGG + Intergenic
975499124 4:75065742-75065764 TTTGAAAGTCAGAAGGAAGTAGG - Intergenic
975635889 4:76447710-76447732 AGTGTAAGGCAGCAGGAGGAAGG + Intronic
975747130 4:77485742-77485764 TGTGAAAGGAAGGAGGAAGAAGG + Intergenic
975823127 4:78291603-78291625 AATAAAAGGAACAAGGAAGAAGG - Intronic
975859677 4:78663504-78663526 AAAGAAAGGCAAAAGGGAGAGGG - Intergenic
976008547 4:80459558-80459580 ACTGAGGGGCATAAGGCAGAAGG - Intronic
976365164 4:84225104-84225126 AAAGAAGGGAAGAAGGAAGAAGG + Intergenic
976656480 4:87493907-87493929 ACTGAATGGCAGAGTCAAGAGGG - Exonic
976848986 4:89523515-89523537 ACTGAAATGCAGAAAGATGAAGG + Intergenic
976996091 4:91436192-91436214 ACAGAAAGTAAGAGGGAAGATGG - Intronic
977086579 4:92606459-92606481 AGTGAGAGGAAGAAGAAAGAAGG + Intronic
977266110 4:94856737-94856759 ACAGAAAGGCAGTAGAAAGGTGG + Intronic
977354941 4:95933551-95933573 ACTGAAAGGCACAGGAAAAAAGG + Intergenic
977581889 4:98734605-98734627 TCCGAAAGGCAGAAGCAAAATGG - Intergenic
978066056 4:104404304-104404326 ATTGAAAGGCAGAAAGAATCAGG - Intergenic
978153723 4:105466556-105466578 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
978290341 4:107130389-107130411 ACTGAAAGGCAGAAGGTAGCAGG + Intronic
978300416 4:107263710-107263732 AATGAAAGAAGGAAGGAAGAGGG + Intronic
978834965 4:113137645-113137667 AAAGGAAGGAAGAAGGAAGAAGG - Intronic
978854567 4:113379755-113379777 ACATAAGGGAAGAAGGAAGAAGG + Intronic
978943041 4:114460429-114460451 GGTCAAAGGTAGAAGGAAGAAGG - Intergenic
979257856 4:118623377-118623399 ACTGAACTCCAGGAGGAAGAGGG - Intergenic
979262104 4:118660193-118660215 TGTGAAAGACAGAAGAAAGAGGG - Intergenic
979295423 4:119027240-119027262 TCTGACAGGCAGAAGACAGAAGG + Exonic
979330493 4:119417185-119417207 ACTGAACTCCAGGAGGAAGAGGG + Intergenic
979631057 4:122903677-122903699 ACTGCAAGGCTGGAGGAGGAAGG + Intronic
980128969 4:128800977-128800999 ACTGAAAGTGAGAAAGAAAATGG + Intergenic
980571544 4:134626764-134626786 ACTGAAGGGCATAAAGCAGAAGG + Intergenic
980589966 4:134873648-134873670 ACTGACAGAGAGAAGGTAGATGG + Intergenic
981651916 4:147069903-147069925 ACTGCAAGGAAGAAGGAGCAGGG - Intergenic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982271296 4:153591997-153592019 ACTGAAAGTTAGAGGTAAGAGGG - Intronic
983406310 4:167335475-167335497 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG + Intergenic
983552567 4:169032466-169032488 AGGAAAAGGAAGAAGGAAGAGGG - Intergenic
984084480 4:175291993-175292015 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
984707370 4:182857495-182857517 ACTCTAAGGCTGAAGGAAGTGGG - Intergenic
984781800 4:183533211-183533233 ACTGAAGGGCAGCAGGGAGAGGG + Intergenic
984853878 4:184176559-184176581 ACTGAACTGCAGGAGGGAGAAGG + Intronic
985191270 4:187376036-187376058 TATGAAAGGCACAAGTAAGAAGG - Intergenic
985340832 4:188951812-188951834 ACTGAAAGGCTGATGGAAATGGG + Intergenic
985342566 4:188970981-188971003 ACTGAAAGTGAAAAAGAAGATGG + Intergenic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
986040311 5:3987892-3987914 ATGGAAGGGCAGATGGAAGAAGG + Intergenic
986066614 5:4240611-4240633 ACGGAGGGGCAGAAGGCAGAAGG - Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
986478342 5:8158947-8158969 ACAGAAAGGGAAAATGAAGAAGG - Intergenic
986768295 5:10948249-10948271 ACTCAAATGCAGGTGGAAGAAGG + Intergenic
986902784 5:12457667-12457689 ACTGAAAGCCAGAAAGCACAAGG - Intergenic
986977804 5:13412573-13412595 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
987182173 5:15379639-15379661 TTTGAAAGGCAGAAAGAAGAAGG + Intergenic
987335854 5:16896988-16897010 ACGGGAAGGCAGAAGGAAGAAGG + Intronic
988236198 5:28548500-28548522 TCTGACAGACAGAAAGAAGATGG + Intergenic
988331192 5:29842028-29842050 ACAAAAAGGCAGAAGTAGGAAGG + Intergenic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
988698537 5:33649009-33649031 AATGAAAGGCTGAAGGTAAAGGG - Intronic
989223128 5:38992258-38992280 AAAGAAAGGGAGAAGGAAGGAGG + Intronic
989337420 5:40335166-40335188 ATAGAAAGGCATAAGGAAAAGGG - Intergenic
989346340 5:40434102-40434124 AATGGAGGGCAGAATGAAGAGGG - Intergenic
989357146 5:40556333-40556355 AAAGAAGGGTAGAAGGAAGAAGG - Intergenic
989490342 5:42044904-42044926 ATTGAAAAGCAGTAGGGAGAGGG - Intergenic
989781332 5:45267984-45268006 TCTGGAAGGCAGAAAGCAGATGG + Intronic
989820822 5:45794249-45794271 ACTGAAGGGCATAAGGCAGAAGG + Intergenic
989985309 5:50690150-50690172 CCTGAGAGGCTGCAGGAAGAAGG - Intronic
989999827 5:50879896-50879918 ACTGAAAGGCATAAGGCAGAAGG - Intergenic
990018583 5:51097970-51097992 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
990114281 5:52369291-52369313 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
990168894 5:53025618-53025640 ACTGAAAGGCCGGAAGAAAAAGG - Intronic
990318055 5:54602571-54602593 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
990421813 5:55642981-55643003 ACTGAAATGCAAAAGAAGGAAGG - Intronic
990684185 5:58281738-58281760 ACCCAAATGCAGCAGGAAGAGGG + Intergenic
990764575 5:59168092-59168114 ACAAAAATACAGAAGGAAGACGG + Intronic
990799251 5:59581394-59581416 ACTAAAAGGAAGAAGCAAAAAGG + Intronic
991048237 5:62245262-62245284 ACTGATGGGCAGAAGGCAGAAGG - Intergenic
991386110 5:66092268-66092290 AGTGAAAGCCTGCAGGAAGAAGG - Intergenic
991559542 5:67934988-67935010 TGTGAAGGACAGAAGGAAGAAGG + Intergenic
991648398 5:68825214-68825236 GGTGAAAGCAAGAAGGAAGAAGG + Intergenic
991673957 5:69074573-69074595 ACTCGAAGGGTGAAGGAAGATGG + Intergenic
992399121 5:76395538-76395560 ACTGAGGGGCATAAGGCAGAGGG - Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992751174 5:79863625-79863647 ACTGAAAAGCAGAAGTATTAAGG - Intergenic
992767111 5:80011444-80011466 ACTAAAAGGAAGAAGGGAGAAGG + Intronic
992949553 5:81844841-81844863 ACAGGAAGGAAAAAGGAAGATGG + Intergenic
993138115 5:83996370-83996392 ACTGAGCAGCAGAAGGAACAAGG + Intronic
994175488 5:96706448-96706470 AGTGAAAGGTTAAAGGAAGAGGG + Intronic
994214974 5:97127533-97127555 AATGAAGTGCAGAGGGAAGAAGG + Intronic
994266578 5:97723493-97723515 ACTGCAAGGCAGCAGCAAGGCGG - Intergenic
994754016 5:103772825-103772847 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
995191399 5:109322443-109322465 ACTGAGGGGCATAAGGTAGAAGG - Intergenic
995482897 5:112610398-112610420 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
995789548 5:115870604-115870626 GCTCAAAGGCAGAAAGAAGCAGG - Intronic
995807259 5:116067034-116067056 TCTGAAAGGCAGAGAGAAGGAGG - Intergenic
996221853 5:120942511-120942533 TCAGAAGGGCAGAAGGAAGTTGG + Intergenic
996698656 5:126426201-126426223 AGTGATATGCAGAAGGAATAAGG + Intronic
996960829 5:129247210-129247232 ACTGATTCTCAGAAGGAAGAAGG - Intergenic
996998131 5:129724481-129724503 ACTGAGAAGCATAAGGCAGAAGG + Intronic
997170635 5:131716189-131716211 TATGGAAGACAGAAGGAAGAAGG + Intronic
997293441 5:132754340-132754362 ACTGGAAGGAAGGAGGCAGAGGG - Intronic
997592493 5:135084180-135084202 ACTGGAAAGCAGATGGATGAGGG - Intronic
997752651 5:136362728-136362750 ACAGAAAGACAAAAAGAAGATGG - Intronic
998555774 5:143122264-143122286 ACAGCAAGGCAGAAACAAGATGG - Intronic
998755387 5:145372670-145372692 AATGAAAAGCAAAAGGAAGCAGG - Intergenic
998766442 5:145493079-145493101 AATAAAAGGCACATGGAAGAGGG - Intronic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
998796095 5:145820710-145820732 ACTGAGGGGCATAAGGCAGAAGG + Intronic
999063386 5:148658986-148659008 AGAGAAAGGAACAAGGAAGATGG + Intronic
999125001 5:149240089-149240111 ACTGAGAAGCAGCAGGAAGGTGG + Intronic
999750770 5:154626874-154626896 AGAGAAAGGGAGGAGGAAGAAGG + Intergenic
999866643 5:155707441-155707463 ACTAAAAGGCTGCAGAAAGAAGG + Intergenic
999889373 5:155960145-155960167 AATGAAGAGGAGAAGGAAGATGG - Intronic
1000089577 5:157918652-157918674 ACCGAAGGGCACAAGGCAGAGGG + Intergenic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000822955 5:166007993-166008015 GCTGGAGGGCAGAGGGAAGAGGG - Intergenic
1001098152 5:168792178-168792200 GCTGGAAGGCAGATGGGAGATGG + Intronic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001206215 5:169765693-169765715 ACAGAAAGAGAGAGGGAAGAAGG + Intronic
1001737821 5:174021195-174021217 AGTGAGAGGGAGAGGGAAGACGG + Intergenic
1002366344 5:178715508-178715530 ACTGAAACGGAGAAGGAACTAGG - Intronic
1002854840 6:1027450-1027472 GCTGAAAGGCCGAAGGAACAAGG + Intergenic
1003093759 6:3126149-3126171 ACTGAAATGCAGAAGGGGTATGG - Intronic
1003114776 6:3276564-3276586 ACTGAAAGGCAGAGGACAGGAGG - Intronic
1003454480 6:6269027-6269049 AAGTAAAGGCAGAAGGAAGAAGG + Intronic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1003702317 6:8481372-8481394 ACTGAAATGTGGAAAGAAGAAGG - Intergenic
1004131216 6:12921667-12921689 AGGGAAAGGAAGAAGGAGGAAGG + Intronic
1004212421 6:13662851-13662873 ACTTAATGGCAGACTGAAGATGG + Intronic
1004700140 6:18071107-18071129 ACAGACACACAGAAGGAAGATGG - Intergenic
1005008042 6:21309817-21309839 GCTGAAAGGCAGCGGGGAGAGGG - Intergenic
1005033021 6:21529082-21529104 ATTGAAAAGGAGAAAGAAGAAGG - Intergenic
1005115071 6:22327056-22327078 GCAGGAAGGCAGAAGCAAGAGGG + Intergenic
1005863409 6:29918621-29918643 ACGGAAAGGAGGAAGGGAGAAGG - Intergenic
1006298933 6:33183095-33183117 ACTGCAAGGCAGGCAGAAGACGG + Intronic
1006720560 6:36147463-36147485 AGTCAAAGGCAGGAGGAAGCTGG - Intergenic
1006864968 6:37201982-37202004 AGTCAAAGGCAGCAGGAAGATGG + Intergenic
1006880268 6:37332768-37332790 ACCGAAGGGGAAAAGGAAGAGGG - Exonic
1007038278 6:38698337-38698359 ATGGAAAGGAGGAAGGAAGAAGG - Intronic
1007106601 6:39287505-39287527 TCAGAAAGGAAGAAGGAAAAAGG - Intergenic
1007179284 6:39916805-39916827 ACTGAAAGAGAGAAAGCAGATGG + Intronic
1007240809 6:40423888-40423910 ACAGAAAGACAGAAGGAACTGGG + Intronic
1007301820 6:40873388-40873410 ACAGAGAGAGAGAAGGAAGATGG - Intergenic
1007518377 6:42431397-42431419 ACAGAGAGGCAGAAAGAAAAAGG + Intronic
1007736254 6:43984099-43984121 ACAGAGAGACAGAGGGAAGAAGG - Intergenic
1007839630 6:44705086-44705108 ACTGAGAGGCAGATGGAAGGTGG - Intergenic
1008019891 6:46564531-46564553 ACAGAAGGCCAGAAGGAAGGAGG + Intronic
1008142375 6:47846704-47846726 ACTGAAAGGAACACAGAAGAGGG - Intergenic
1008402540 6:51080172-51080194 ACTGATAGGAAGAAAGTAGAAGG + Intergenic
1008939616 6:57032049-57032071 ACTGAAGGGCATAAAGTAGAAGG + Intergenic
1009457003 6:63869357-63869379 AGAGAAAGAAAGAAGGAAGAGGG - Intronic
1009950440 6:70389226-70389248 ACTGAAATTCAGAAAGATGAAGG - Intergenic
1010335889 6:74683201-74683223 GCTGAAAGGTAGAAAGAAGAAGG + Intergenic
1010532986 6:76990336-76990358 ACTGAAAGAAAGAAGGGAAATGG + Intergenic
1010813255 6:80324457-80324479 AGTGAAAGGCAGAAAAGAGATGG + Intronic
1010977293 6:82330040-82330062 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1011161411 6:84394476-84394498 AGTAAAAGAAAGAAGGAAGAAGG - Intergenic
1011295486 6:85822586-85822608 ACTGAAAGGGAGAAAGCTGAAGG - Intergenic
1011526449 6:88270375-88270397 ACTGAAAGGGAGAATTAAAAGGG + Intergenic
1011869799 6:91879379-91879401 TCTGAAATTCAAAAGGAAGAAGG + Intergenic
1012060273 6:94469560-94469582 ATTGAAGGGCAACAGGAAGATGG - Intergenic
1012192637 6:96299557-96299579 ACTGAATGGCATAAGGCATAAGG + Intergenic
1012473406 6:99595521-99595543 ACAGAAAGATAGAAGGAAGCAGG - Intergenic
1012767241 6:103383687-103383709 ACAGAAAGGCATAAGCCAGAAGG + Intergenic
1013274972 6:108575637-108575659 ACTGAAATGCAAAAGTATGAAGG - Intronic
1013306978 6:108857543-108857565 ACTGAAAAGCAGTAGTAAGAGGG + Intronic
1013327028 6:109056572-109056594 AGAGACAGGCAGAAGGAAGTTGG - Intronic
1013394594 6:109722646-109722668 AATGAAAGCCAGAATGAAGAGGG - Intronic
1013536917 6:111071405-111071427 AAAGAAAGACAGAAGAAAGAAGG - Intergenic
1013684625 6:112565210-112565232 ACTGACGGGCATAAGGCAGAAGG + Intergenic
1013859677 6:114620045-114620067 ACTGAAAAGCTGAAGCAATATGG + Intergenic
1013994747 6:116295183-116295205 ACTTGAAGGCAGAAGAAAGGTGG + Intronic
1014149819 6:118041780-118041802 TCAGAAAGACAGAAGGAAGGTGG + Intronic
1014269393 6:119319868-119319890 TTTTCAAGGCAGAAGGAAGAGGG - Intronic
1014504938 6:122243186-122243208 CCTGAAAGGCACACTGAAGAAGG + Intergenic
1014927833 6:127295912-127295934 ACTGGAACACAGAAGGCAGAAGG + Intronic
1015631528 6:135236553-135236575 AAAGGAAGGAAGAAGGAAGAAGG - Intergenic
1016863371 6:148743834-148743856 ACTGAAGGGAAGAAAGCAGAGGG + Intergenic
1016903122 6:149121471-149121493 CCTGAAAGGTAGAAAGAAGAGGG + Intergenic
1017041134 6:150309327-150309349 AAGGAAAGACAGAAGGAAGGAGG + Intergenic
1017213128 6:151879161-151879183 CCTGAGAGGCAGAAGGAACTGGG + Intronic
1017322057 6:153105802-153105824 ACAGACAGGCAGAAGGAATCAGG + Intronic
1017436249 6:154418272-154418294 AGAGAAAGGCAGAATGATGACGG - Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017789171 6:157780757-157780779 ATTGAAAGAAAGAAGAAAGAAGG - Intronic
1018097735 6:160406702-160406724 ACAGAGAGGCAGAAAGAAGAAGG - Intronic
1018175058 6:161171406-161171428 AGGGGAAGGCAGAAGGCAGAAGG + Intronic
1018476625 6:164148899-164148921 ACTAAAAGGAAGAGGGTAGAGGG + Intergenic
1018619417 6:165715549-165715571 AATGAAGGGGAGAAGGAGGAGGG + Intronic
1019074316 6:169375385-169375407 ACCCAAGGGCAGAAGGCAGAGGG + Intergenic
1019817732 7:3213422-3213444 ACTGAGGGGCATAAGGTAGAAGG - Intergenic
1020410135 7:7883046-7883068 GAAGAAAGGAAGAAGGAAGAAGG + Intronic
1021287075 7:18793551-18793573 AAGGAAGGGCAGAAGGAAGAGGG + Intronic
1022078288 7:26994875-26994897 ACAGAAAGACAGAAGGAAGGAGG + Intronic
1022096904 7:27146882-27146904 TCTGAAGGGCAGAAAGGAGAGGG + Intronic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022593467 7:31688544-31688566 ACTGAAAGGGGGAAGGAACTGGG - Intronic
1023088890 7:36599833-36599855 ACTGAGAGGCAGAAAGCAGGAGG - Intronic
1023207692 7:37768736-37768758 AATGAAAAGAAGTAGGAAGAAGG + Intronic
1023399845 7:39784663-39784685 ACTGAACTCCAGGAGGAAGAGGG - Intergenic
1023495145 7:40787517-40787539 ACTGAAAGACAGAGAGAAGAAGG + Intronic
1023687361 7:42749975-42749997 CCTGAAAGTCACAAGGTAGAAGG - Intergenic
1023752748 7:43387445-43387467 ACATACAGGCAGAAGCAAGAAGG - Intronic
1024049057 7:45606580-45606602 ACTAAAAGTCAGAGGGAAGAAGG - Intronic
1024072782 7:45800447-45800469 ACTGAACTCCAGGAGGAAGAGGG - Intergenic
1024097604 7:45996403-45996425 CATGAAGGGCAGAAGGAAGTGGG + Intergenic
1024184952 7:46940288-46940310 ACTGCAGGGCAGAAATAAGATGG - Intergenic
1024195701 7:47056855-47056877 TCTGAAAGGTAGTAAGAAGAAGG - Intergenic
1024385196 7:48743081-48743103 ACTAAAATGCAGAAATAAGAGGG + Intergenic
1024650558 7:51399733-51399755 ACTGAACTCCAGGAGGAAGAGGG + Intergenic
1024678983 7:51663762-51663784 AGGGAAAGGCAGGGGGAAGAAGG - Intergenic
1024774424 7:52765873-52765895 TCTGAAACACAGAAGGCAGAAGG - Intergenic
1025054676 7:55755317-55755339 ACTGAACTCCAGGAGGAAGAGGG + Intergenic
1025184394 7:56845949-56845971 ACTGAACTCCAGGAGGAAGAGGG + Intergenic
1025911243 7:65830531-65830553 ACTGAACTCCAGGAGGAAGAGGG - Intergenic
1026797230 7:73374108-73374130 TTTGAAAGGCAGAAGGCACAAGG - Intergenic
1027463000 7:78478711-78478733 CCTGAAAGGTGGAAAGAAGAAGG + Intronic
1027616557 7:80431302-80431324 ACTGAGGGGCATAAGGTAGAAGG - Intronic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1027859820 7:83563264-83563286 ACTTAAAGGCAGAAGGACTGTGG + Intronic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1028380063 7:90190238-90190260 ACTGAAAGCCAGCAGGAAGATGG - Intronic
1028590629 7:92489931-92489953 AATGAAAGATGGAAGGAAGAGGG + Intronic
1028626169 7:92880289-92880311 ACTGAAAGCAAGAAGGGAGAAGG + Intergenic
1028808534 7:95057774-95057796 ACTGAAAGGGCATAGGAAGAAGG - Intronic
1028985489 7:97005719-97005741 ACTCAAAGGGAGGAGGAAGGAGG - Exonic
1028997530 7:97117620-97117642 ACCGGAAGGCAGACGAAAGAGGG - Exonic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029249358 7:99224967-99224989 AAAGAAAGAAAGAAGGAAGAGGG - Intergenic
1030159460 7:106492611-106492633 ACTGAAAAACAGAGGGAAGGAGG + Intergenic
1030285203 7:107819022-107819044 TGTGAAAGATAGAAGGAAGACGG + Intergenic
1030365492 7:108641305-108641327 AAAGAAAGGAAGAAGAAAGAAGG - Intergenic
1030515553 7:110533792-110533814 ACTGAGAGGCATAAGGCAGAAGG - Intergenic
1030518707 7:110569570-110569592 ACTGACAAGCAGAAAGAAGGAGG - Intergenic
1030681647 7:112440643-112440665 GATGAAAGGCAGTAGGAAGTAGG - Intronic
1031680853 7:124673067-124673089 ATTGAAAGGTACAAGGAAGGAGG - Intergenic
1031783042 7:125994226-125994248 AAAGAAAGAAAGAAGGAAGAAGG - Intergenic
1031944120 7:127820699-127820721 AATGGAAGGCAGAAGGAAAGGGG - Intronic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1031999298 7:128254385-128254407 ACTGCTATGCAGGAGGAAGAGGG - Exonic
1032025576 7:128439276-128439298 ACAGACAGACAGAGGGAAGATGG - Intergenic
1032050159 7:128644136-128644158 ACTGAACTCCAGGAGGAAGAGGG - Intergenic
1032318014 7:130858472-130858494 ACTGCAATGCAGCAGTAAGAGGG + Intergenic
1032379283 7:131459312-131459334 ACAGAAAGGCAGAGGAAAGTTGG + Intronic
1032870300 7:135977527-135977549 ACTGGGAGGCAGAATGAAGGAGG + Intergenic
1033528755 7:142243112-142243134 AGGGAAGTGCAGAAGGAAGAAGG - Intergenic
1033581691 7:142743168-142743190 ACTGAAAGCCAGATGCAAAAAGG - Intergenic
1033673033 7:143511392-143511414 GCAGAAAGGCAGGTGGAAGATGG + Intergenic
1033684412 7:143625295-143625317 ACTGAAATCAGGAAGGAAGAAGG - Intronic
1033687588 7:143704514-143704536 ACTGAAATCAGGAAGGAAGAAGG - Intronic
1033700199 7:143832328-143832350 ACTGAAATCAGGAAGGAAGAAGG + Intergenic
1034207561 7:149330911-149330933 ACTGCAGGGCAGATGGAACAGGG + Intergenic
1034477857 7:151297961-151297983 ATTGGCAGGCAGATGGAAGACGG + Intergenic
1034696461 7:153058526-153058548 ACTGAAAGGCCAAAGGAAGGCGG - Intergenic
1034727465 7:153351026-153351048 TCTGAAAGGTAGAGGGGAGAAGG - Intergenic
1034993872 7:155566037-155566059 ACTGAGAGACAGCAGGGAGACGG + Intergenic
1034999872 7:155604070-155604092 ACTGCAAGGGAGGAGGGAGAGGG + Intergenic
1035522926 8:289962-289984 AAGGAAAGGAAGAGGGAAGAAGG - Intergenic
1035552075 8:536164-536186 ACTGAAGGGTAGAATGATGAGGG - Intronic
1036625969 8:10471789-10471811 ACTGAGGGGCATAAGGAAGAGGG + Intergenic
1036962461 8:13259992-13260014 AATGAAAAGCAGAAGGAATTTGG + Intronic
1037029137 8:14080535-14080557 AATGAAAGGAATAAGGAAGGTGG - Intergenic
1037410906 8:18596085-18596107 AATTAAAAGCAGAAGGAAAATGG + Intronic
1037968975 8:23158215-23158237 ACTGAGGGGCATAAGGCAGAAGG - Intronic
1038118740 8:24588054-24588076 CCTGAAAGGAAGAAGTAAAATGG - Intergenic
1038717305 8:30003425-30003447 ATTCAAAGGCAGAACAAAGAAGG + Intergenic
1038978079 8:32723809-32723831 GCTGAAAGGAAGAAAGAAGAAGG + Intronic
1039429944 8:37517853-37517875 ATTGAAAGGCAGCAGGGAGCTGG - Intergenic
1039436608 8:37563856-37563878 CCACAAAAGCAGAAGGAAGAAGG + Intergenic
1039468467 8:37799507-37799529 TATCAAAGGCAGAAGGAAGTGGG + Intronic
1039507760 8:38064333-38064355 ACTGAAAGGCGCCAGGAAAAAGG - Intergenic
1039729094 8:40255432-40255454 ACGGAGGGGCAGAAGGCAGAAGG + Intergenic
1039762164 8:40589712-40589734 AAGGAAAGGAAGAAGGAAGAAGG - Intronic
1040391013 8:46950561-46950583 ACTCAGAGTCAGGAGGAAGATGG - Intergenic
1040515197 8:48128840-48128862 AAAGAAAGAAAGAAGGAAGAGGG - Intergenic
1040743526 8:50611261-50611283 ACTCAGAGGCAAAGGGAAGAAGG - Intronic
1040862321 8:52012045-52012067 TCAGGAAGGAAGAAGGAAGAGGG - Intergenic
1041321526 8:56618740-56618762 TCTGAGAGACAGAAGGAAGAAGG - Intergenic
1041362394 8:57066990-57067012 AGAGAAAGGCAGGAGGAAAAGGG - Intergenic
1041375103 8:57204606-57204628 ACTGAGGGGCACAAGGCAGAGGG + Intergenic
1041673984 8:60519338-60519360 ACTCAATGGCAGAAGCAAGGTGG - Intronic
1041742843 8:61175614-61175636 ATTTAAAGGCACAGGGAAGAAGG + Intronic
1042014525 8:64293336-64293358 TCTGAGAGGCAGTGGGAAGAAGG - Intergenic
1042348385 8:67750784-67750806 ACAGAAAGGCTGAATGGAGATGG - Intergenic
1042395457 8:68286420-68286442 TCTGAAAGGCAGTAAGAGGAAGG - Intergenic
1042455660 8:68999518-68999540 TCTGAAAGGTAGAGAGAAGAAGG - Intergenic
1043277615 8:78419557-78419579 ACTGAAAGGCAGAATTTAAAAGG - Intergenic
1043417305 8:80064089-80064111 AAGGAAAGGCGGAAGGAAGTTGG + Intronic
1043524779 8:81084148-81084170 TCTGAAAGGTAGAGGAAAGATGG - Intronic
1043589959 8:81819394-81819416 ATCGAAATGCAGAAGCAAGAAGG - Intronic
1043599581 8:81920666-81920688 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1043704680 8:83333143-83333165 TATGAAATGAAGAAGGAAGAGGG + Intergenic
1043950162 8:86299780-86299802 ACTCAAAGGCAGAGAGAAGAAGG - Intronic
1043950250 8:86300856-86300878 AAGGAAAGGGAGGAGGAAGAAGG + Intronic
1044084361 8:87925840-87925862 GCTGAAAGGTAGAAAGAAGAAGG + Intergenic
1044085511 8:87937765-87937787 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1044329001 8:90894297-90894319 ACTCAAAGGCAGAATTAACAAGG - Intronic
1044586030 8:93869808-93869830 CCTGAAGGGAAGAAGGGAGAAGG - Intronic
1044672222 8:94693930-94693952 AGTGAAAAGCTGAAGGAAGGTGG + Intronic
1044778179 8:95715590-95715612 AGGGAAAGGAAGAAGGAAGGAGG - Intergenic
1044894268 8:96873027-96873049 AGTGCAAGGAAGAAGGAAGATGG - Intronic
1045085406 8:98677542-98677564 AGAGGAAGGAAGAAGGAAGAAGG + Intronic
1045133877 8:99191082-99191104 ACTGAAATGCTGAAAGAAAAAGG - Intronic
1045186265 8:99841657-99841679 ACTGAGAAGCAGTAGGCAGAAGG - Intronic
1045531613 8:102990384-102990406 AAAGAAAGGCAGAAAGAAGCTGG - Intergenic
1045634027 8:104161962-104161984 ACTGGAAGGCAGAAGGGATAAGG - Intronic
1045653050 8:104360028-104360050 ACTGAAAGTCAGAAAAAAGAAGG + Intronic
1045831617 8:106468483-106468505 ACTGTAAAGCAGAAGTAAGCTGG + Intronic
1045848839 8:106669362-106669384 ACTGAAAAGAAGCAGAAAGATGG + Intronic
1045884098 8:107075919-107075941 ACTGCATGGAAGAGGGAAGAAGG + Intergenic
1046039093 8:108880523-108880545 ACAGAAAGATAGAAGGAATATGG - Intergenic
1046115325 8:109777339-109777361 ACTGCAATGCAAAAGAAAGAGGG - Intergenic
1047152145 8:122275675-122275697 AATGAAAGGCAGAAGAGAGCAGG + Intergenic
1047219050 8:122903982-122904004 CCTGAAAAGTGGAAGGAAGAAGG + Intronic
1047562586 8:126005039-126005061 AATGGAAGGTAGAAAGAAGAAGG + Intergenic
1048803103 8:138212491-138212513 CCTGAAAAGCAAAAGGCAGAGGG - Intronic
1048977872 8:139683103-139683125 CCTGATAGGAAGAAGGAAAAGGG + Intronic
1049010891 8:139886687-139886709 TATGAAAGGAAGAAGGAAGGTGG - Intronic
1049331249 8:142054934-142054956 CCTGAAAGGTTGAGGGAAGAAGG - Intergenic
1049628819 8:143639993-143640015 ACTTAAAGGAAGAAGGAAACAGG + Intronic
1049696468 8:143986464-143986486 ACTGAAAGACGGAAGGAGGGAGG + Intronic
1050233495 9:3554195-3554217 AGTGGAAGGGAGAAGGAAGCAGG - Intergenic
1050488069 9:6156068-6156090 ACTCAAAGGTAGCAGAAAGAAGG + Intergenic
1050561743 9:6841251-6841273 ACTGAAACTCAGGAGAAAGATGG + Intronic
1051033463 9:12713222-12713244 ACTGAAGGGTAGAAGGAGGCAGG + Intergenic
1051106534 9:13587294-13587316 AATGACAGGAAGTAGGAAGATGG - Intergenic
1051506657 9:17834551-17834573 ACTAAAAGGGTGAAGGAAAATGG + Intergenic
1051706683 9:19888342-19888364 AGAGAAAGGCAGAAGAAATAAGG - Intergenic
1051769317 9:20558987-20559009 ACTAAAAGGCTGAATGATGAGGG + Intronic
1052340847 9:27362850-27362872 TCTGTAAGGCAGAAGGGAAAAGG - Intronic
1052387686 9:27841264-27841286 ATAAAAAGGGAGAAGGAAGAAGG - Intergenic
1052587865 9:30452184-30452206 ACTGAAGGGGATAAAGAAGAAGG - Intergenic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1055147134 9:72949333-72949355 AATGAAAGTCAGGATGAAGAAGG + Intronic
1055540217 9:77296455-77296477 AATGACAGAAAGAAGGAAGAGGG - Intronic
1055776864 9:79775781-79775803 TCTGAAATCCAGAAGGGAGAGGG + Intergenic
1055862409 9:80768406-80768428 TCAGAGAGTCAGAAGGAAGACGG + Intergenic
1056089192 9:83187736-83187758 AATGGAAGGTAGAGGGAAGAAGG - Intergenic
1056619340 9:88197815-88197837 CCTGAAAGCCAGAAAGAAGAAGG - Intergenic
1056692795 9:88822486-88822508 TCTGAAAGGGAGAAAGAGGAGGG - Intergenic
1057201826 9:93144582-93144604 ACTTGCAGGGAGAAGGAAGAAGG + Intergenic
1057841760 9:98491303-98491325 ACTGAAAGGTTGAAGGTAAAAGG - Intronic
1057873536 9:98735705-98735727 ACTGAAAGCTAGGAAGAAGAAGG + Exonic
1058801453 9:108548305-108548327 ACTAAAACTCAGAAGGATGAAGG - Intergenic
1059208880 9:112492509-112492531 CATGAAAGGCAGTAGGTAGAGGG - Intronic
1059451716 9:114375298-114375320 ATTGCACGGCAGAAGTAAGAAGG + Intronic
1059672319 9:116503160-116503182 AAAGGAAGGAAGAAGGAAGAAGG + Intronic
1059998764 9:119939458-119939480 TCAGAAAGGCAGCTGGAAGATGG + Intergenic
1060055460 9:120409196-120409218 AATGAAAGGCTGCAGAAAGAAGG - Exonic
1060444902 9:123679076-123679098 ACTGAAAGTCAGGAGGCAGGGGG + Intronic
1060542848 9:124442567-124442589 CATTCAAGGCAGAAGGAAGAGGG + Intergenic
1061229075 9:129301952-129301974 TCTGAAAGGTAGAAAGAAGAAGG - Intergenic
1061531603 9:131218497-131218519 TTTGAAAGGCAGAAGGAACCAGG - Intronic
1062207073 9:135343103-135343125 GCTGAGAGGCAGGAGGAAGCTGG - Intergenic
1062229224 9:135472175-135472197 CCTGAAAGGCAAAAGGAGGTTGG - Intergenic
1185482232 X:455461-455483 ACTCAAGGGCAGCAGGATGATGG - Intergenic
1185772188 X:2773265-2773287 ACTGAGGGGAGGAAGGAAGAAGG + Intronic
1185886737 X:3789999-3790021 ACTGAAGGGCATAAGGCAGAAGG - Intergenic
1186020074 X:5245172-5245194 AGTGAAGTGAAGAAGGAAGAAGG - Intergenic
1186253359 X:7693159-7693181 AGTGGAAGACAGAAGGCAGAAGG - Intergenic
1186348336 X:8717633-8717655 ATAGAAAGGGAGAGGGAAGAGGG + Intronic
1186743068 X:12538254-12538276 ACTGAAAGGCAGCAGCAGGCTGG + Intronic
1186965524 X:14782673-14782695 ATTGAAAGCCACAGGGAAGAAGG + Intergenic
1187509941 X:19908636-19908658 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1187515862 X:19969285-19969307 ACTGAAATGCACAAGCAAAATGG + Intronic
1187774162 X:22736610-22736632 ACTAAAAGGCAAATGAAAGAAGG + Intergenic
1188043569 X:25399289-25399311 ACTAGAAGGCAGAGGGAGGAAGG + Intergenic
1188284490 X:28311498-28311520 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1188368572 X:29340707-29340729 TCAGAAAGGAAGAAGGAAAAGGG - Intronic
1188581874 X:31723759-31723781 TTTGAAAAGCAGAAGGAAGCTGG - Intronic
1188611209 X:32100110-32100132 CCTGAAAGGGAGAAGTAAAAAGG + Intronic
1188883345 X:35518061-35518083 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1189234357 X:39476140-39476162 AATGAAAGGCAGACAGAAAAGGG + Intergenic
1189442340 X:41048667-41048689 ACTGAAAGGCAGAGAGAAAAAGG - Intergenic
1190571316 X:51784967-51784989 TCTGAAAGGTAGAAAGAAGAAGG - Intergenic
1190795442 X:53736941-53736963 TCTGAAAAGTAGAAAGAAGAAGG + Intergenic
1191127048 X:56968110-56968132 ACTGACAACCAGAAGGAAAATGG + Intergenic
1191172791 X:57466772-57466794 ATTGAAAGGCAAAAGGTATAGGG + Intronic
1191636188 X:63379781-63379803 ACTGAAGGGAAGATGGAAGGTGG - Intergenic
1191845675 X:65545919-65545941 ACTGTCAGACAGAAGGCAGAAGG - Intergenic
1191910790 X:66147225-66147247 TCTGAAAGATAGAAAGAAGAAGG - Intergenic
1192191025 X:68991213-68991235 AAAGAAGGGAAGAAGGAAGAGGG - Intergenic
1192334174 X:70203793-70203815 ACATAAAGACAGAGGGAAGAAGG + Intronic
1192353167 X:70373323-70373345 AAGGAAAGGAAGAAGGAAGAAGG + Intronic
1192459496 X:71304777-71304799 ATGAAAAGGGAGAAGGAAGAGGG - Intronic
1193148261 X:78099850-78099872 ACTCCAAGCCACAAGGAAGATGG + Intronic
1193192831 X:78592939-78592961 ACTGAGAGCCATAAGGCAGAGGG - Intergenic
1193201608 X:78697948-78697970 ACTAAAAGGAAGAGGGAAGATGG + Intergenic
1193732330 X:85116229-85116251 ATTGAGAGGCATAAGGCAGAAGG + Intergenic
1193968693 X:88022865-88022887 ACTGAGAGGCGTAAGGTAGAAGG + Intergenic
1194161921 X:90464674-90464696 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1194215237 X:91123336-91123358 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1194238567 X:91414996-91415018 TTTGGAAGGCAGAAGGGAGACGG - Intergenic
1194627595 X:96243664-96243686 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1194986539 X:100495808-100495830 GCTGGAAGCCTGAAGGAAGAGGG + Intergenic
1195635390 X:107108431-107108453 AGTGAATGGCAGCAGGAGGAAGG + Intronic
1195641787 X:107183492-107183514 TCTGAAAGGTAGAGAGAAGAAGG + Intronic
1195804086 X:108743143-108743165 AGGAAAGGGCAGAAGGAAGAAGG + Intergenic
1195823192 X:108969655-108969677 ACTGAAAGGGGCATGGAAGAGGG + Intergenic
1197575809 X:128209848-128209870 ATTGAAAGCCAAAAGCAAGAAGG + Intergenic
1197707721 X:129646528-129646550 AGGGAAGGGCAGAAGGAAGGAGG - Exonic
1197837688 X:130712842-130712864 ACTGAGGGGCATAAGGAAGAAGG - Intronic
1197883781 X:131196654-131196676 CATGGAAGGAAGAAGGAAGAGGG - Intergenic
1198572194 X:137969951-137969973 GATGATAGGGAGAAGGAAGAGGG - Intergenic
1198608360 X:138369533-138369555 ACTGAAAGGAAGAGCGAACAAGG + Intergenic
1198843843 X:140888176-140888198 CCTGATAGGCAGAAAGAAAATGG + Intergenic
1198957790 X:142150665-142150687 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1199082402 X:143591517-143591539 ACTGAGAGGCATAAGGTAGAAGG + Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199289263 X:146088207-146088229 ACTGTAAGGCTTAATGAAGAAGG + Intergenic
1199511897 X:148631678-148631700 ATTGAAAGGCAGGGGGAGGAGGG + Intronic
1199549173 X:149039932-149039954 ACTCCATGGCAGAAGGCAGAAGG + Intergenic
1199666572 X:150100970-150100992 ACAGAAAGGAAGAAGCCAGATGG - Intergenic
1199880983 X:151974314-151974336 ACAGGACGCCAGAAGGAAGACGG - Intronic
1200464184 Y:3494605-3494627 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1200508202 Y:4042419-4042441 ACTGAGAGGCATAAGTCAGAAGG + Intergenic
1201470163 Y:14324481-14324503 AATGGAAGACAGAAGGCAGAAGG - Intergenic
1201910024 Y:19124528-19124550 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1201968368 Y:19763410-19763432 TCTGAAAGGCAGGAGCAGGATGG + Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202384184 Y:24308667-24308689 TGTGAAAGACAGAAGAAAGAGGG - Intergenic
1202486599 Y:25361453-25361475 TGTGAAAGACAGAAGAAAGAGGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic