ID: 1001203364

View in Genome Browser
Species Human (GRCh38)
Location 5:169739301-169739323
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001203361_1001203364 17 Left 1001203361 5:169739261-169739283 CCAGAAACTGGGAGGCAGGTGAA No data
Right 1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG 0: 1
1: 0
2: 1
3: 24
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900467617 1:2833424-2833446 CTGTGATTGCAGGGGAAAAATGG - Intergenic
901156765 1:7145463-7145485 CTGTAACTTCAGAGAGAAAATGG + Intronic
901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG + Intergenic
906362453 1:45175363-45175385 CTTTAATTATAAGGGGAAAAAGG - Intronic
906704391 1:47884306-47884328 CAGAACTTGGAGAGGGAAAAAGG - Intronic
907116295 1:51971301-51971323 CTTTCATTGTAAAGGGAAAGGGG - Intronic
907848701 1:58233608-58233630 CTGTAATTGTATAAGGAAATAGG + Intronic
908079270 1:60558202-60558224 AGGTAATTGGAGAAGGAAAAAGG + Intergenic
908207666 1:61868013-61868035 CTATATTTGTGGAGGGCAAATGG + Intronic
908649765 1:66319338-66319360 CTTTATTTGTAGAATGAAAATGG - Intronic
909062830 1:70898826-70898848 TTGAGATTTTAGAGGGAAAAAGG - Intronic
909156455 1:72083802-72083824 CTATCCATGTAGAGGGAAAATGG - Intronic
909344917 1:74573331-74573353 CTGACATAGTACAGGGAAAAGGG - Exonic
910290584 1:85596660-85596682 CTGGAATTGTAGAAGGAAGCGGG - Intergenic
912079134 1:105913217-105913239 CTGGACTTATAGAGGGAGAAAGG - Intergenic
912118291 1:106435406-106435428 CAGTATTTGTAGACAGAAAAAGG + Intergenic
912136979 1:106672653-106672675 CAGTAATTGCAGAAGGCAAAGGG - Intergenic
913313219 1:117524870-117524892 CTGTAACTGTAGAAGGGAAAAGG + Exonic
914880408 1:151542035-151542057 TTGGAATAGTTGAGGGAAAAGGG + Intronic
916350638 1:163845743-163845765 CAGTAATTGTAGAGGTATCATGG - Intergenic
916581697 1:166114981-166115003 CTCAAATTTTAGAGGGGAAAGGG + Intronic
916591944 1:166199936-166199958 CTATAATTGTATTGGGAAATTGG + Intergenic
917165804 1:172111638-172111660 CTGTAATCTTATTGGGAAAATGG + Intronic
917423944 1:174893961-174893983 ATGTAATTACAGAGGAAAAAAGG - Intronic
918366106 1:183809528-183809550 ATGTTATTGTAAAGGGAAAATGG - Intronic
919413639 1:197278507-197278529 TTTTAATGGCAGAGGGAAAAAGG + Intronic
919504705 1:198384805-198384827 CTATCATTTTAGAGGGACAAGGG - Intergenic
920849623 1:209619761-209619783 CTCTAGTTGTAGAGTGAAACTGG - Intronic
921235258 1:213120391-213120413 TTGTTATTTGAGAGGGAAAATGG + Intronic
922626154 1:227045781-227045803 CTGTTTTTGTTGAAGGAAAAAGG - Intronic
922987198 1:229874954-229874976 CTGTAAAGGGAGAGGAAAAATGG + Intergenic
923044985 1:230349167-230349189 CACTAACTGTAGAGGGAGAAGGG + Intronic
923607634 1:235459099-235459121 TTGTAATTGTGGAAGAAAAATGG + Intronic
924075059 1:240325036-240325058 CTGTGGTTGTAGAATGAAAAGGG + Intronic
924844171 1:247748912-247748934 CTGTATTTGTATAGGTAAATAGG - Intergenic
924939725 1:248804637-248804659 CTGAAATTGTAAAGTGAAAGAGG + Intergenic
1063149633 10:3324521-3324543 CTCTAATTGTGGAAGCAAAAGGG - Intergenic
1064814806 10:19247949-19247971 CAGTATTTGTAGACAGAAAAAGG + Intronic
1068507808 10:57925009-57925031 CTGTAATTGTATAGAGGAACGGG - Intergenic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1070237663 10:74646494-74646516 CTGTAGTTAAAGAGAGAAAATGG + Intronic
1070244969 10:74722099-74722121 GAGTAGTTGTAGAGGGAAAGTGG - Intergenic
1071368137 10:84922370-84922392 CTGTATCTGTGGAGGGACAATGG + Intergenic
1071861273 10:89675216-89675238 CTAAAATTGTAGAGGAAAAAAGG + Intergenic
1073676010 10:105647868-105647890 CTGAAACTGCAGAGGGCAAAAGG + Intergenic
1073861069 10:107741288-107741310 CTATATTTATAGAGGGAAAGAGG + Intergenic
1075180342 10:120205227-120205249 CTTTAATTCAAGAAGGAAAATGG - Intergenic
1075284276 10:121169615-121169637 CTGGAAGTGTTGAGTGAAAATGG - Intergenic
1075966167 10:126613646-126613668 CAGTGATTGAAGAGGGATAAAGG - Intronic
1077519394 11:3022847-3022869 CTCTAATGGTAGAGGAAAAGGGG - Intronic
1078299943 11:10118651-10118673 CTAAAATTGGAGATGGAAAATGG - Intronic
1078442973 11:11382825-11382847 GTATAATTGTGGAAGGAAAAGGG + Intronic
1078770360 11:14344446-14344468 CCTTAATTTTAGAGGCAAAAAGG + Intronic
1082181716 11:49127970-49127992 CTGTAGTTGTATGGGCAAAAGGG - Intergenic
1082980305 11:59114766-59114788 CTGACACTGTAGAGGGAGAAAGG + Intronic
1083917624 11:65759311-65759333 ATGTTATTGTTGAGGGAAACAGG - Intergenic
1085891377 11:80584134-80584156 ATGTAATTTTAGAGGTAGAATGG - Intergenic
1085907169 11:80777466-80777488 CTGTGGTTGTAGTGGGAAAATGG - Intergenic
1086493887 11:87383224-87383246 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1086934162 11:92725886-92725908 GTCTACTTGTAGAGGGATAATGG - Intronic
1087063170 11:94002638-94002660 CTTTAATGGTAGAAGGAAGAAGG + Intergenic
1088315244 11:108499549-108499571 CTGTAATCGAAGTGGGAGAAGGG + Intergenic
1088482941 11:110312957-110312979 CTTTAAATGGAGAGGAAAAATGG + Intergenic
1090767856 11:129892628-129892650 CTGGAAATGTAGAGTGGAAAAGG + Intronic
1092967776 12:13661375-13661397 CTGGAAGTGTAGAAGGCAAAAGG - Intronic
1094032869 12:26033551-26033573 TTGTTATTTTGGAGGGAAAAAGG + Intronic
1094481384 12:30885130-30885152 CTGTAACTGTACAAGGAATATGG + Intergenic
1095330895 12:40962283-40962305 TTGTAATTGTGGGTGGAAAAGGG + Intronic
1095331622 12:40972099-40972121 CTGGAATTGGAAAGTGAAAATGG + Intronic
1097401379 12:59132282-59132304 CTGCATTTGTCAAGGGAAAAGGG + Intergenic
1098678158 12:73316647-73316669 CTTTAATTCAAGAAGGAAAATGG - Intergenic
1099782206 12:87210374-87210396 CTGTAAATGTAAAGGCACAAGGG + Intergenic
1100479205 12:94961568-94961590 CTGTAATTCTAAAGGGTGAATGG + Intronic
1100610234 12:96185877-96185899 CTGAAATTGGACAGGGAAGAGGG - Intergenic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1100931800 12:99618458-99618480 CTTTAATTCAAGAAGGAAAATGG + Intronic
1101245977 12:102884798-102884820 ATGTAACTTTAGAGGAAAAAGGG - Intronic
1102854642 12:116282772-116282794 ATGTAATGGCAGAGAGAAAATGG + Intergenic
1103050958 12:117779060-117779082 CTGTCTTTGCAGAGGGAAATTGG - Intronic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106882720 13:34149374-34149396 CTTAATTTCTAGAGGGAAAATGG + Intergenic
1107099283 13:36571977-36571999 GTGTAAGTGTAAAGAGAAAAGGG - Intergenic
1107114043 13:36727211-36727233 CTGTTATTGTGGAGGGAACAGGG - Intergenic
1107264958 13:38542591-38542613 GTGTGAATATAGAGGGAAAATGG - Intergenic
1108562764 13:51662547-51662569 GTGTATTTGTATAGGGGAAAGGG - Intronic
1108789652 13:53952256-53952278 ATGTATTTCTAGAGGAAAAATGG - Intergenic
1109173967 13:59132432-59132454 CTGTAAGTGTACAGGGAAAGAGG - Intergenic
1109283103 13:60379787-60379809 ATGTAATTGTAGATAGAAATAGG + Intergenic
1109410563 13:61960790-61960812 TCGTAACTGTAGAGAGAAAAAGG + Intergenic
1109796459 13:67320107-67320129 CTGCAAATCAAGAGGGAAAATGG - Intergenic
1110128504 13:71978310-71978332 CTCTAATTCAAGAAGGAAAATGG + Intergenic
1111415557 13:87938993-87939015 CTGCAATTCTTGAGGGGAAATGG + Intergenic
1111796777 13:92931038-92931060 CTGTAGTTGTAGAGAGACCAGGG + Intergenic
1111878310 13:93923312-93923334 CAGTAATTGTTCGGGGAAAAGGG + Intronic
1112741338 13:102476457-102476479 CTGTAGGTGTAGAGCAAAAACGG - Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113743694 13:112728104-112728126 CTGCCATTGTAGCAGGAAAAAGG + Intronic
1116426894 14:44801455-44801477 CTGTAATGGTAGATGAAACATGG + Intergenic
1116754155 14:48925090-48925112 CTGTTATTGTAGATCGTAAATGG - Intergenic
1117319228 14:54605140-54605162 CTGTAATTGTCAAGTGAAACAGG - Intronic
1117363521 14:55001771-55001793 CTGAAATTTTAGAGGAAGAAAGG - Intronic
1117728542 14:58697518-58697540 CGGTATTTGAACAGGGAAAATGG + Intergenic
1118679343 14:68223534-68223556 GTGTAATTGTTAAGGGAATATGG + Intronic
1118766390 14:68912357-68912379 CTCTACTTCTAGAGGGAAACAGG + Intronic
1119184060 14:72625202-72625224 GAGTAAATGTAGAGGGAAAGGGG - Intronic
1120120788 14:80678516-80678538 CTTTAATTCCAGAAGGAAAATGG + Intronic
1120479252 14:85028222-85028244 CTGTAAATGTCTAGGGAAACTGG + Intergenic
1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG + Intergenic
1120715880 14:87840293-87840315 CTGTAACTGCAGAGGGAGACTGG - Intronic
1120919968 14:89745649-89745671 AGGTAATTGCTGAGGGAAAAGGG + Intergenic
1122754400 14:103966686-103966708 CTAAAATTGGAGAAGGAAAAAGG - Intronic
1123772148 15:23539498-23539520 CTGTAACTCTGAAGGGAAAAAGG - Intergenic
1123823739 15:24059952-24059974 ATGTAATTGAAGAGGGAAGGAGG + Intergenic
1123833380 15:24164516-24164538 CTGTAATCATAGATGGGAAATGG + Intergenic
1123840111 15:24239595-24239617 CTGTAATCATAGATGGGAAATGG + Intergenic
1123853054 15:24380110-24380132 CTGTAATCATAGATGGGAAATGG + Intergenic
1124378230 15:29141954-29141976 CTGTAATTGCATAAGGAAATAGG + Intronic
1125109522 15:36014617-36014639 CTGTTATTTTAAAGGGAGAAAGG - Intergenic
1125383638 15:39114003-39114025 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1125397728 15:39268621-39268643 TTATAATTGCAGAGAGAAAAAGG + Intergenic
1126510543 15:49467293-49467315 GTGAAATTGAAGGGGGAAAATGG - Intronic
1127563562 15:60164612-60164634 GTTTAATTGTAGGAGGAAAATGG - Intergenic
1128774798 15:70311995-70312017 CTGTGATTGAGGAGGGAACAGGG - Intergenic
1130063902 15:80589362-80589384 CTGTAAATGTTGATGGCAAAGGG + Intronic
1133180186 16:4048543-4048565 CTGCACTTGTAGAGGGACACGGG + Intronic
1135418598 16:22288698-22288720 CTTTATTTGTAAAGAGAAAATGG - Exonic
1135949997 16:26905305-26905327 CTGTAACTGGAGAGGGAAAGTGG - Intergenic
1143042898 17:4052511-4052533 CTGTGATTCTGGAGTGAAAAAGG - Intronic
1144353094 17:14417610-14417632 CAATATTTGTAGAGAGAAAAAGG + Intergenic
1144360395 17:14486595-14486617 CAGTAATGGGAGAGGGAGAAAGG - Intergenic
1144440056 17:15273042-15273064 CTGAAATTGTTGGGTGAAAAGGG - Intergenic
1146136493 17:30325878-30325900 CCCTTATTGTAGAGGAAAAAAGG - Intronic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1150534246 17:66019343-66019365 ATGTAATTGTAGAGCTAAATGGG - Intronic
1151039143 17:70838231-70838253 CAGTAATTGTTAAGGAAAAATGG + Intergenic
1151412645 17:73941476-73941498 CTGTAATTTTCTAGGAAAAAGGG - Intergenic
1152875192 17:82782397-82782419 CTGTAATTAAAGAGAGAAGAAGG - Intronic
1154528259 18:15314764-15314786 CTTTAGATGTGGAGGGAAAAGGG + Intergenic
1154938768 18:21089895-21089917 CTGAGATTGTAGTTGGAAAAGGG + Intronic
1155057695 18:22199391-22199413 CTGAACTTTTAGAAGGAAAAAGG + Intronic
1156069276 18:33186773-33186795 CTAGAATTGTGGAGGGAAAGAGG - Intronic
1157739708 18:50081460-50081482 CTGTAAAGGTGGTGGGAAAAGGG + Intronic
1161857829 19:6775824-6775846 GTGAAAGGGTAGAGGGAAAAAGG + Intronic
1162232898 19:9282404-9282426 CAGTAAGTGTTGAGGGAAATAGG - Intergenic
1165529178 19:36382415-36382437 CTGGAATTCTAGAGGCAAGAGGG + Intergenic
1166610859 19:44194806-44194828 CTAAAATTTTAAAGGGAAAAGGG - Intergenic
1167005644 19:46774983-46775005 CTGTTATTGTGGAGGGAATAGGG + Exonic
1168476094 19:56676406-56676428 CTGTACTTGGAGATGGAGAAAGG - Intergenic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
931059667 2:58512968-58512990 CTGTCATTGGAGAGTGAAATGGG - Intergenic
931563658 2:63590580-63590602 CTGGAATTGTAGAATTAAAAGGG + Intronic
931671077 2:64648348-64648370 CAATAATTGTAGAAAGAAAAAGG + Intronic
932130188 2:69180491-69180513 TTGTAACTGTGGATGGAAAAAGG - Intronic
932464507 2:71907698-71907720 CTGTTACTGTAGATGGACAAAGG - Intergenic
933866856 2:86527362-86527384 CTTTATTCATAGAGGGAAAAAGG + Intronic
934166579 2:89299496-89299518 TTGCTTTTGTAGAGGGAAAAGGG + Intergenic
934200698 2:89882960-89882982 TTGCTTTTGTAGAGGGAAAAGGG - Intergenic
935148958 2:100417060-100417082 TTGTAATTGTAGATGGAGAGAGG - Intronic
937646675 2:124273494-124273516 CTCTAATTGTAAGGGGAAGATGG - Intronic
938215644 2:129510933-129510955 AGGCACTTGTAGAGGGAAAATGG + Intergenic
938234762 2:129696750-129696772 CTTTATTTGCAGAGTGAAAATGG + Intergenic
939124727 2:138164610-138164632 CTTTAATTCAAGATGGAAAATGG + Intergenic
939304513 2:140393580-140393602 CTGAAATAGAAGATGGAAAATGG - Intronic
939596729 2:144134442-144134464 TTGACATTGAAGAGGGAAAAAGG - Intronic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
940352216 2:152702978-152703000 CTTGAGTTGTAGAGGGGAAAGGG - Intronic
940430009 2:153578685-153578707 CTGCAATTCTACAGGCAAAATGG - Intergenic
940771222 2:157841297-157841319 CTGTGATTGTCGAAGGAGAAGGG - Intronic
941142259 2:161799590-161799612 CTGGCATTGTGAAGGGAAAAGGG + Intronic
941336450 2:164250162-164250184 CTGTCAATGTAGATGGAATAGGG - Intergenic
941469135 2:165862784-165862806 CTTTCATTTTAGAGGTAAAAAGG - Intronic
941920294 2:170843704-170843726 CTATAATCTTAGAGGTAAAAGGG + Intronic
942003231 2:171671853-171671875 CAGTAATTGAATAGGAAAAATGG + Intergenic
942778673 2:179614838-179614860 CTTTTATTATAGAGGGTAAATGG + Intronic
943188438 2:184645766-184645788 CTCTAATTCAAGAAGGAAAATGG + Intronic
943249152 2:185494992-185495014 CTTTAATTCAAGAAGGAAAATGG - Intergenic
943428023 2:187760189-187760211 GTGTATTTGTAGGGGGACAATGG + Intergenic
944960076 2:204862716-204862738 CTGCAACAGTAGAGGGGAAAAGG - Intronic
947410415 2:229832304-229832326 CTGTAATTATAGCGTGAAAGCGG - Intronic
947646435 2:231745011-231745033 CTGTAATTTTAGGGGTGAAAAGG + Intronic
1169138749 20:3214242-3214264 CTGTAAGTGGAGATGGTAAAGGG + Intronic
1169671419 20:8106646-8106668 CTTTAATTCGAGAAGGAAAATGG - Intergenic
1169701128 20:8447864-8447886 CTGAAATTGTAGAGTGCAAAGGG - Intronic
1169865895 20:10199600-10199622 CTGTCAATGTAGAGAGAAAGGGG - Intergenic
1170778504 20:19402310-19402332 CTGTAATCGTTAGGGGAAAAAGG - Intronic
1172430109 20:34883208-34883230 TTGTAGTTGAAGAGGGAGAAAGG + Intronic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173416144 20:42857879-42857901 CTGGGATTGTAGAGGGAATAGGG - Intronic
1177732488 21:25046117-25046139 TTGTCATTGTAGAAGTAAAAGGG + Intergenic
1180015094 21:45076492-45076514 CTGTAGTTGGAAAGGAAAAAAGG + Intronic
1181665944 22:24397168-24397190 CTGTTTTGGCAGAGGGAAAATGG - Intronic
1181848492 22:25732561-25732583 CTGTAATTTGAGAAGGGAAATGG + Intergenic
1183016002 22:34987638-34987660 ATGTAATTGAAAAGGTAAAATGG + Intergenic
1183155213 22:36069622-36069644 CTGTAACTGTAAAGGGAACCTGG - Intergenic
949231528 3:1756485-1756507 CTTTAATTCAAGAAGGAAAATGG + Intergenic
949520523 3:4848944-4848966 CTTTACTTGTAGAGAGAAACAGG - Intronic
949612868 3:5720836-5720858 CTGTGCTTGCAGAGGTAAAATGG - Intergenic
949732319 3:7128003-7128025 CTATAATTTTAGAGAGATAAAGG + Intronic
950598566 3:14009277-14009299 CTGTAATAGGAGATGGAACACGG - Intronic
950977737 3:17267362-17267384 CTGACATTGAAGAAGGAAAAAGG - Intronic
951236202 3:20239772-20239794 CTGTAATTCAGGAAGGAAAATGG + Intergenic
951750802 3:26034104-26034126 ATGTAATTTTAAAGGAAAAAAGG + Intergenic
952814230 3:37432941-37432963 CTGTAATGGAATAGGGCAAAAGG + Intronic
955059489 3:55483329-55483351 CTGGGATTGAAGAGGGAAGAGGG - Intronic
955694304 3:61620388-61620410 TTGAATTTGCAGAGGGAAAATGG + Intronic
955873027 3:63459932-63459954 CGGAAATTGTGGAGGGAAAATGG - Intronic
956221397 3:66907666-66907688 CTGTAATTGCTGAGGGAACCAGG - Intergenic
956262259 3:67356947-67356969 CTGTAGTTGAAAAAGGAAAATGG - Intergenic
956288204 3:67632720-67632742 CTCCAATTGCAGATGGAAAACGG + Intronic
956313563 3:67909060-67909082 GTCTCATGGTAGAGGGAAAAGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957518742 3:81291281-81291303 CTGTAATTTTAGGGTTAAAATGG - Intergenic
959391943 3:105786083-105786105 ATGAAAGTGTAGAGTGAAAAAGG + Intronic
959739200 3:109696095-109696117 CTTTAATTCAAGAAGGAAAATGG - Intergenic
959739288 3:109697396-109697418 CTTTAATTCAAGAAGGAAAATGG - Intergenic
959753979 3:109874900-109874922 CTTTAATTCAAGAAGGAAAATGG + Intergenic
959883799 3:111475803-111475825 CTGTATATGTAGAGGAAGAAAGG + Intronic
961532217 3:127546865-127546887 CTGAAGTTCTAGGGGGAAAAAGG + Intergenic
961973554 3:130996045-130996067 CTGCAATCGAAGAGGGTAAAGGG + Exonic
963547111 3:146672846-146672868 CTTTAATTCAAGAAGGAAAATGG - Intergenic
963597982 3:147352707-147352729 CTGTAATAATATAGGGAAAGAGG + Intergenic
963956623 3:151261387-151261409 CTGGAATTGTGGAGGGTAAGAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968140643 3:196253396-196253418 CTGGACTTGTTTAGGGAAAATGG - Intronic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
970540278 4:17070998-17071020 ATCTCAGTGTAGAGGGAAAAAGG - Intergenic
970548015 4:17149208-17149230 CTGTATCAGTAGAGTGAAAATGG + Intergenic
970982514 4:22117253-22117275 CTGTAATAGCAGAGGGGAAAAGG + Intergenic
971949892 4:33331777-33331799 CTTTATTTCAAGAGGGAAAATGG + Intergenic
973884446 4:55306419-55306441 CTTTTCTTGTAGAGAGAAAAGGG + Intergenic
974786032 4:66620333-66620355 CTTTAATTCAAGAAGGAAAATGG - Intergenic
975903873 4:79186641-79186663 CTGTAATTCTAGTGGGAAGGAGG + Intergenic
976340154 4:83938148-83938170 CTGTAATGGAAGAGGGATAGAGG - Intergenic
976469763 4:85414653-85414675 CTGTAGATGTAGAGTGGAAATGG + Intergenic
976577424 4:86690194-86690216 CTCTAGTTAAAGAGGGAAAATGG - Intronic
977697956 4:99987930-99987952 CTGCATTTGTAGTGTGAAAATGG - Intergenic
977749924 4:100597167-100597189 GTATAATTGGAGAGAGAAAATGG - Intronic
979046691 4:115874538-115874560 ATGTAAGTGAAGAGGGAAATAGG + Intergenic
979517996 4:121633456-121633478 CTGTAAATGTGCAGAGAAAAGGG + Intergenic
979799876 4:124895038-124895060 CTGTATTAGTGGAGGCAAAATGG + Intergenic
980294649 4:130895992-130896014 CGGTATTTATAGACGGAAAAAGG - Intergenic
984496609 4:180505999-180506021 CTTTATGTGTAGATGGAAAAGGG - Intergenic
984869050 4:184310836-184310858 TTGTTATTGTTGAGGGAATATGG - Intergenic
986345238 5:6828719-6828741 CTGAAATTTTAGAGGGACAAAGG + Intergenic
986767747 5:10942730-10942752 CTGTAATGGTAGAGAAAAAGAGG + Intergenic
988551739 5:32206424-32206446 CTGTAATTGTTTAGGAAAAATGG - Intergenic
989643957 5:43608912-43608934 CTCCAATTTTAGTGGGAAAATGG + Intronic
990988796 5:61664999-61665021 CTTAGATTGTAGAGGGAATACGG - Intronic
991173421 5:63655956-63655978 GTGTAATTGGAGAGGAAATAGGG + Intergenic
991487622 5:67154190-67154212 CTGTAAATGGAGAGAGAGAAAGG + Intronic
993008937 5:82458361-82458383 CTTTAATTCAAGAAGGAAAATGG + Intergenic
993922961 5:93830059-93830081 CAGTAATTGTAGTGGAAAACAGG + Intronic
995417772 5:111929080-111929102 CTTTAGTTGTAGAGGGGATAAGG - Intronic
995546228 5:113234610-113234632 CTGTATTTTTAAAGGGAAATTGG - Intronic
996478043 5:123943057-123943079 CTGTTATGGTACAGGGAAAAGGG - Intergenic
997130605 5:131272403-131272425 CTGAAAATGAAGAGGAAAAAAGG - Intronic
997290259 5:132727392-132727414 CAGGAATTGTAATGGGAAAAAGG + Intronic
998068672 5:139179508-139179530 CTGCTTCTGTAGAGGGAAAATGG - Intronic
999451875 5:151684785-151684807 CTTTAACTGTAGAGGGAATGGGG + Intronic
999827137 5:155284502-155284524 CTGTATCTGTATTGGGAAAAGGG + Intergenic
1000118883 5:158178188-158178210 CTGTAACTGCAGAGAGAGAAGGG - Intergenic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1001270575 5:170308392-170308414 TTGTCATTGTGGAGGGACAAAGG + Intergenic
1002357669 5:178643927-178643949 CTGCCACTGTAGAGGGAAAGCGG - Intergenic
1002827859 6:790101-790123 TTTTAATTGGAGAGGGAAAAGGG + Intergenic
1003671883 6:8166629-8166651 CTTTAAATGTAAGGGGAAAAGGG + Intergenic
1004089342 6:12484543-12484565 GTGTTATTGGACAGGGAAAAAGG - Intergenic
1004365284 6:15007737-15007759 CTATAATTGCATGGGGAAAATGG + Intergenic
1004871979 6:19914464-19914486 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1006051083 6:31344911-31344933 CTGAGATTGTAGTGGGACAAAGG + Intronic
1007750762 6:44069770-44069792 CTGAAATTTTAGAGGCAGAAGGG + Intergenic
1008583878 6:52931329-52931351 TTGCAATTGTAAAGGGAAATGGG + Intergenic
1008679679 6:53858644-53858666 CTGTAATTTTAGAGATAAACTGG + Intronic
1009508422 6:64516636-64516658 CTGTAACTGTGCAGAGAAAAGGG - Intronic
1010354333 6:74912574-74912596 CTTTAATTCAAGAAGGAAAATGG - Intergenic
1011954863 6:93014906-93014928 CTTTAATTCAAGATGGAAAATGG + Intergenic
1012016461 6:93858403-93858425 CCGTAATTGTTGTGGGAGAAAGG - Intergenic
1012745531 6:103082483-103082505 CAGTATTTATAGATGGAAAAGGG - Intergenic
1013752759 6:113426229-113426251 GAGTAATTGCAGAGAGAAAATGG - Intergenic
1014142772 6:117963511-117963533 CGATAATATTAGAGGGAAAAAGG + Intronic
1015537241 6:134278949-134278971 GTGTAAATGGAGAAGGAAAAAGG + Intronic
1015717491 6:136207356-136207378 CTGTCATTGTAGGAGGAAGAAGG - Intergenic
1016709692 6:147155760-147155782 GTGTAATGCTAGAGGGTAAAAGG + Intergenic
1017358461 6:153537827-153537849 TATTAATTGGAGAGGGAAAAGGG - Intergenic
1018596614 6:165487860-165487882 CTGCAAGTGTGCAGGGAAAAGGG - Intronic
1018673120 6:166195778-166195800 CTGGAATAGTAGAGGGAATGCGG + Intergenic
1020744877 7:12068399-12068421 CTTTAGTTGTAGAGGGAAAAGGG - Intergenic
1021809586 7:24390442-24390464 CTCTAATCGTAGAGAGAAAGTGG - Intergenic
1023105445 7:36759432-36759454 TTGTAGCTGTGGAGGGAAAAGGG - Intergenic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1027468407 7:78543207-78543229 ATGTGAATGTAGAGAGAAAAAGG + Intronic
1028760020 7:94485656-94485678 GTGAAATTGTAAGGGGAAAAAGG - Intergenic
1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG + Intergenic
1030720783 7:112868304-112868326 CTTTAATTCAAGAAGGAAAATGG + Intronic
1031246122 7:119313976-119313998 CTTTAAATGAAGAGGGAACATGG + Intergenic
1031858962 7:126957264-126957286 ATGTAATTGTTGGGGGAAAGTGG - Intronic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1031904484 7:127446082-127446104 CTTTAATTTAAGAAGGAAAATGG + Intergenic
1031947046 7:127853141-127853163 CTGAAATTGTCGAGGGAAAGAGG + Intronic
1032317972 7:130857799-130857821 CTGTAAATGTGGAGGAAGAAGGG + Intergenic
1032684168 7:134213864-134213886 TTGTAAATATAGATGGAAAATGG - Intronic
1033108747 7:138556537-138556559 CTGTGAATGTAGGGGGAAATAGG + Intronic
1033471100 7:141649905-141649927 CTGTATTGGAAAAGGGAAAAAGG - Intronic
1033679699 7:143582576-143582598 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1033692136 7:143746867-143746889 CTTTAATTCAAGAAGGAAAATGG - Intergenic
1035968930 8:4226362-4226384 TTGTAATTGTATATGCAAAATGG - Intronic
1037288600 8:17326926-17326948 TTGTAAATAAAGAGGGAAAAAGG + Intronic
1037486360 8:19351108-19351130 CTGTTATTTTAGAAGCAAAAAGG + Intronic
1039136147 8:34324919-34324941 CTGTAATTAAATAGGTAAAATGG - Intergenic
1039428247 8:37504873-37504895 CTGTATTTGTAGGGAGAAACAGG - Intergenic
1039797957 8:40931541-40931563 CTGTAACTGTACAGGGCAGAAGG + Intergenic
1040006370 8:42624604-42624626 CAGTAATTTTAAAGGGAAAAGGG - Intergenic
1041167466 8:55103298-55103320 CTGTAATGGGTGGGGGAAAAGGG + Intronic
1041403275 8:57467191-57467213 CTGTAATTGTTGAATGAAGATGG - Intergenic
1042085747 8:65106772-65106794 AGGTGATTGTTGAGGGAAAAAGG + Intergenic
1044406860 8:91837391-91837413 ATGTAATTTTAGGGAGAAAATGG + Intergenic
1046089622 8:109485574-109485596 CTATAATTGTTGAGGAAAGAAGG + Intronic
1047943771 8:129853154-129853176 CTGTAATTATTGAGGGTAAAAGG + Intronic
1048475751 8:134740988-134741010 TGGTTATGGTAGAGGGAAAAGGG - Intergenic
1049140250 8:140948092-140948114 CTGTAAGTGTATAGGGAAGCAGG - Intronic
1050687584 9:8189683-8189705 CTTTAATTTAAGAAGGAAAATGG + Intergenic
1052069682 9:24067082-24067104 CTGGAACTGGAGAGGGAGAAAGG + Intergenic
1052290175 9:26831108-26831130 CTGAACTTGTAGAGGGAACTTGG - Intergenic
1052410054 9:28111467-28111489 CTGGAATTGTACAGAAAAAAAGG + Intronic
1055958393 9:81795803-81795825 CTATAATTCTCAAGGGAAAATGG - Intergenic
1056250376 9:84742087-84742109 CTGTAAATGTCAAGGGAAAACGG - Intronic
1056884296 9:90425815-90425837 GTTTAAGTATAGAGGGAAAATGG - Intergenic
1058355077 9:104074861-104074883 CTGGAATGGGAAAGGGAAAATGG + Intergenic
1058375307 9:104316081-104316103 CGGTAATGGGAGAGGGAGAAGGG - Intergenic
1059801118 9:117750485-117750507 CTGTACTTGGAGAGGAAAGATGG - Intergenic
1185934849 X:4244788-4244810 CTGTGTTTGAAGACGGAAAAGGG + Intergenic
1186365045 X:8883451-8883473 TTGTAAATGTAAAAGGAAAATGG - Intergenic
1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG + Intergenic
1191055119 X:56232914-56232936 CTGAATTGGTAGAGGTAAAAGGG + Intronic
1191895362 X:65987031-65987053 CTGTTATAGAAGAGGGAGAAGGG + Intergenic
1193031696 X:76906121-76906143 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1193177921 X:78416568-78416590 CAATAATTGTAAAGGGAATAGGG - Intergenic
1193418119 X:81249011-81249033 CTTTAATTCAAGAAGGAAAATGG - Intronic
1193550948 X:82892241-82892263 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1194923719 X:99797422-99797444 CTTTAATTCAGGAGGGAAAATGG - Intergenic
1195427156 X:104747358-104747380 CAGTAATTGTTGAAGGAAAGAGG - Intronic
1195734694 X:108000537-108000559 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1196053233 X:111327754-111327776 GTGGAAGTGGAGAGGGAAAATGG + Intronic
1196560034 X:117135254-117135276 CAGTAAGTGAAGAAGGAAAAGGG - Intergenic
1197032853 X:121839099-121839121 TTGTGATTCTAGAGGGAGAAGGG - Intergenic
1197267375 X:124389559-124389581 TTGTGATTCTAGAGGGAAAAAGG - Intronic
1197390699 X:125860626-125860648 CTTTAATTCAAGAAGGAAAATGG + Intergenic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic