ID: 1001206258

View in Genome Browser
Species Human (GRCh38)
Location 5:169766006-169766028
Sequence TATCATTGCAGCATTGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001206255_1001206258 -1 Left 1001206255 5:169765984-169766006 CCTATATCTTTTCTAATCAACAT 0: 1
1: 0
2: 1
3: 36
4: 383
Right 1001206258 5:169766006-169766028 TATCATTGCAGCATTGGGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001206258 Original CRISPR TATCATTGCAGCATTGGGCT AGG Intronic
903600946 1:24539376-24539398 TATCATTGAACCATTGGGGCTGG + Exonic
903779680 1:25813309-25813331 CGTCAGTGCAGCAGTGGGCTGGG + Intronic
905041243 1:34960899-34960921 TATTCTTGAAGCATTGGGCCAGG + Intergenic
905567044 1:38973846-38973868 TAACATTGTGGCATTTGGCTGGG + Intergenic
906181566 1:43824596-43824618 TAGCATTGCAGGATTTGGCTAGG + Intronic
908097719 1:60757915-60757937 TACCATGGCTGCTTTGGGCTAGG - Intergenic
910019993 1:82575790-82575812 TATCATTTTAGCATTGAACTAGG + Intergenic
910301471 1:85711354-85711376 TCTCTTTGCAACCTTGGGCTAGG - Intergenic
912893967 1:113565138-113565160 TTTCATTTCAGGGTTGGGCTCGG - Intronic
913173990 1:116257198-116257220 TAAAATTGATGCATTGGGCTTGG - Intergenic
916060266 1:161093481-161093503 TATCATTAAAGGATGGGGCTGGG - Intergenic
917171793 1:172184752-172184774 TCTCATTGCAGACTTGGGTTTGG + Intronic
917657113 1:177137542-177137564 TATAATTACAGCATTGGAGTAGG - Intronic
919589352 1:199481039-199481061 TAATATTGCAACTTTGGGCTGGG - Intergenic
920444115 1:206002740-206002762 TGGCATTGCAGCACTGGGCAAGG + Intronic
923674526 1:236068357-236068379 TGTGTATGCAGCATTGGGCTAGG - Intergenic
1066267213 10:33787972-33787994 TATCATTGTAGCATCCTGCTGGG + Intergenic
1067921408 10:50462051-50462073 TATAATTGCAGCACTAGCCTAGG + Intronic
1068427436 10:56885383-56885405 ATTCATTGCAGTATTGGGGTTGG - Intergenic
1069687117 10:70325383-70325405 TATCATTGCAGAACAGGGATGGG - Intronic
1069933345 10:71898539-71898561 TTTAATAGCAGAATTGGGCTGGG - Intergenic
1075245103 10:120814603-120814625 AATCAGTGCAGCATTGTCCTGGG - Intergenic
1075443787 10:122499828-122499850 TAACATTGCAGCAACTGGCTGGG - Intronic
1076754401 10:132561586-132561608 GATCATTGTAGCATTGAGGTAGG + Intronic
1079423949 11:20322779-20322801 TATCATTGCAGTACTGGTCTAGG - Intergenic
1079521577 11:21333678-21333700 AAGCATTGAAGCATTTGGCTGGG + Intronic
1080963882 11:37192138-37192160 TATCATATTAGGATTGGGCTGGG + Intergenic
1084978869 11:72817946-72817968 AATGCTTGCAGCACTGGGCTTGG - Intronic
1092859182 12:12705063-12705085 CATCATTACAGCATTGGGAAAGG + Intergenic
1094708209 12:32935490-32935512 TATGATTGCACCATTGCACTTGG - Intergenic
1095772034 12:45970440-45970462 TGTCATGGCAGGATTGGGCTTGG - Intronic
1104511933 12:129388187-129388209 TATCAGTGCTGAATTGGTCTTGG - Intronic
1107293306 13:38881934-38881956 TATCATTCCAGAAATGGTCTTGG + Exonic
1108106073 13:47011804-47011826 TATCTTTGCAACTTTGGGGTAGG + Intergenic
1108961407 13:56236519-56236541 ATTCATTGCAGCATTGTGCTGGG + Intergenic
1108969769 13:56358965-56358987 TAGCATTACAGAATTGGACTCGG + Intergenic
1110053549 13:70936032-70936054 TTTGATTGCAGAGTTGGGCTTGG + Intergenic
1110093240 13:71481757-71481779 TTTCAGTGCAGCAGGGGGCTGGG + Intronic
1110463537 13:75774919-75774941 TCTCTTTGCAACATTGGGTTAGG - Intronic
1111030641 13:82592740-82592762 GATAATTGCAGCAGTGGGCCAGG - Intergenic
1112319208 13:98391811-98391833 CCTCCTTGGAGCATTGGGCTTGG - Intronic
1113783694 13:112990783-112990805 TTTCCCTGCAGCATTGGGCCTGG - Intronic
1115799790 14:36979992-36980014 TATCATTGAAGCACTGGACTAGG - Intronic
1116375809 14:44199101-44199123 TATCTTTACAGGATTGTGCTAGG - Intergenic
1117131622 14:52693212-52693234 GATCACTGAAGCAGTGGGCTGGG + Intronic
1119095859 14:71830117-71830139 TACCATTGCAGGATTGTCCTGGG - Intergenic
1121768596 14:96509628-96509650 TATCATTGGTGCATAGGCCTAGG - Intronic
1124826380 15:33099988-33100010 TGTCATTGCAACTTTGGGCTTGG + Intronic
1127352326 15:58165842-58165864 TATCAGCACAGCACTGGGCTTGG + Intronic
1128650792 15:69411592-69411614 TATCATTTAGGAATTGGGCTTGG - Intergenic
1128914616 15:71548477-71548499 TAGCCTTGCAGCCGTGGGCTTGG - Intronic
1130965920 15:88697560-88697582 TGGCTTTGCAGCTTTGGGCTTGG - Intergenic
1133565750 16:6991833-6991855 TAACATTTCAGAAGTGGGCTGGG - Intronic
1133734092 16:8600831-8600853 TGTCATTGCAGGCCTGGGCTGGG - Intergenic
1134422429 16:14106779-14106801 TATGAGGTCAGCATTGGGCTGGG + Intronic
1138933526 16:61691288-61691310 AATCAGTGCAGCAATGGCCTAGG - Intronic
1139560617 16:67739414-67739436 TGACATTGAAGCATTGGACTAGG - Intronic
1140963186 16:79937201-79937223 TATCTTTGCATCATTGACCTTGG - Intergenic
1141495092 16:84404065-84404087 GTTCATAGCAGCATTGGGCATGG - Intronic
1142320611 16:89380405-89380427 TAAAATGGCATCATTGGGCTGGG - Intronic
1149694686 17:58607590-58607612 TATAAGGACAGCATTGGGCTGGG + Intronic
1150408610 17:64923637-64923659 TATAATTGGTGCATAGGGCTGGG + Intergenic
1160297826 18:77654255-77654277 TCCCAGTGCAGCATTGGGATAGG - Intergenic
1161263170 19:3348905-3348927 TAAAATTGCAACAATGGGCTGGG - Intergenic
1162045292 19:7995721-7995743 AATCTTTGTGGCATTGGGCTGGG + Intronic
1164098460 19:22032875-22032897 TATAATTTCAGCTCTGGGCTGGG + Intergenic
1164201411 19:23021953-23021975 TATAATTTCAGCTGTGGGCTGGG + Intergenic
1165973549 19:39654839-39654861 TATCATTGAAGGATTTGGTTTGG - Intergenic
926363519 2:12112360-12112382 TTCCATTGCAGCATTGTGATGGG + Intergenic
926677734 2:15640334-15640356 TATTTTTGCAGCATTGGAGTTGG + Intergenic
929160277 2:38824942-38824964 AATGACTGCAGCTTTGGGCTGGG - Intronic
931872422 2:66475778-66475800 TATAACTGCAGCATTGTTCTAGG - Intronic
939874703 2:147564507-147564529 TTTCATTGCAGAATTGGGTGTGG - Intergenic
941116506 2:161479038-161479060 CATCATTGCAGCTCTGGGTTGGG - Intronic
941583695 2:167331349-167331371 GATGATGGCAGCAGTGGGCTGGG + Intergenic
941675245 2:168337174-168337196 TATCAAAGCAGGATTGGGCTTGG + Intergenic
941958255 2:171227199-171227221 TATCATTAGAGCTTGGGGCTGGG - Intronic
1174637008 20:52009841-52009863 TAAAAATGCATCATTGGGCTGGG + Intergenic
1176249615 20:64114163-64114185 CATCCTTGCAGCATTGGCGTCGG + Intergenic
1180913760 22:19471165-19471187 TGTCATTGCAGATCTGGGCTGGG - Intronic
1181591451 22:23887890-23887912 AATCTTTGCAACATTGGGATAGG - Intronic
949896457 3:8770417-8770439 AATCATTCCAGAATGGGGCTGGG + Intronic
951862257 3:27266255-27266277 AGTCTTTGCAGTATTGGGCTAGG - Intronic
961126122 3:124419579-124419601 TATGAGTGAAGCATTGTGCTAGG + Intronic
962475960 3:135755622-135755644 TATGTTTGCAGCATGGTGCTGGG + Intergenic
963988143 3:151621152-151621174 TATGTTTGCAGCATTGTGCCAGG + Intergenic
978039960 4:104047961-104047983 TATCATAACAGCAATGGGCAAGG + Intergenic
979791275 4:124784357-124784379 TGTCATTGCAGGAGTGGGTTAGG + Intergenic
980154709 4:129090519-129090541 AATCTTTGCAGCCTTGGGTTAGG + Intronic
986799319 5:11243282-11243304 TGTCTCTGCAGCCTTGGGCTTGG + Intronic
987286581 5:16464001-16464023 TATATTTTCAGCACTGGGCTAGG - Intronic
989382733 5:40825095-40825117 TATAATTTTAGCATTGGGCCAGG - Intergenic
990746204 5:58961529-58961551 TATCTATGCAGCACTAGGCTAGG + Intergenic
992188894 5:74270841-74270863 TGTCTTTGCAGCCTTGGGTTAGG + Intergenic
992239326 5:74749868-74749890 TATCTTTACAGCCTTGGGGTAGG - Intronic
993877630 5:93326777-93326799 TATCCTTGCAGAGTGGGGCTAGG - Intergenic
994537108 5:101046531-101046553 TATCTTTGCAGGAATGGGTTTGG - Intergenic
998523417 5:142820610-142820632 TATCTGTGCAGCAGTGGGATGGG + Intronic
1001206258 5:169766006-169766028 TATCATTGCAGCATTGGGCTAGG + Intronic
1002631914 5:180587924-180587946 TAACATTTCATCCTTGGGCTGGG + Intergenic
1005005881 6:21287118-21287140 AATCACTGCAGCAGTGGGCCGGG - Intergenic
1008197525 6:48542948-48542970 TAAGATTGCAGCAATTGGCTAGG + Intergenic
1015946565 6:138508044-138508066 TATCATTGCTGCCATCGGCTTGG + Intronic
1016243725 6:141959621-141959643 TTTCATTCCAGCAATGGGATAGG - Intergenic
1016807125 6:148222867-148222889 TATCATTACATCACAGGGCTGGG + Intergenic
1017839758 6:158211536-158211558 TATCTTTACAGCATTGAGATAGG + Intergenic
1019126310 6:169842500-169842522 ACTCAGTGCAGCATTGGGATTGG - Intergenic
1021073860 7:16275763-16275785 GCTCATTGCAGCCTTGGCCTTGG - Intronic
1022064441 7:26836931-26836953 TATCATTGATGCATTTGGGTTGG - Intronic
1022340957 7:29467995-29468017 TGTCTTTGCAGCATGGGTCTTGG + Intronic
1022977286 7:35570439-35570461 AATCATTACAGAATAGGGCTAGG + Intergenic
1024450635 7:49538614-49538636 AATCTTTACAACATTGGGCTTGG + Intergenic
1024580821 7:50799406-50799428 AATCACTGCAGTATTGGTCTAGG - Intergenic
1024774531 7:52767392-52767414 CATCAATTCAGCAGTGGGCTTGG - Intergenic
1031579517 7:123454534-123454556 TATCATTGCAACATGGAGATAGG + Intronic
1032855535 7:135830474-135830496 GTTCATTGCAGCCTCGGGCTGGG - Intergenic
1035089149 7:156291351-156291373 AATAATTGCGACATTGGGCTAGG - Intergenic
1035108012 7:156458205-156458227 TCTCAGGGCAGCATTGGGCGGGG + Intergenic
1036537766 8:9667941-9667963 TATCAGTGCTGTATTGTGCTTGG - Intronic
1040737561 8:50527378-50527400 TATCTTTGCAACCTTGGGGTAGG - Intronic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1041477311 8:58280784-58280806 AATCATGTCAGCATTGGGCAGGG + Intergenic
1044817141 8:96124986-96125008 TATCATTGCACAATTGGGGAAGG + Intergenic
1048478040 8:134760718-134760740 TATGTGTGCAGCATTGGGCTAGG + Intergenic
1048634616 8:136282599-136282621 TATCATTATGGCATTGAGCTGGG + Intergenic
1050474279 9:6023557-6023579 TATCATTTCAGAGTTGGGTTGGG - Intergenic
1051295132 9:15587301-15587323 GATGATTGCATCATTGGGGTGGG + Intronic
1051858363 9:21596002-21596024 GATCATTGAAACAATGGGCTAGG + Intergenic
1055890579 9:81119604-81119626 TATCATTGCTGCATTGGAGCAGG - Intergenic
1059192500 9:112339868-112339890 TATCATTTAAAAATTGGGCTGGG - Intergenic
1059761880 9:117345467-117345489 TATCATTGCAGGATTACGGTAGG - Intronic
1061643193 9:131976325-131976347 CAGCATTGCAGCATTTTGCTGGG - Intronic
1188047992 X:25450314-25450336 TATCATTGATGCATTTGGGTTGG - Intergenic
1189212555 X:39296221-39296243 CATTATTGCAGGAGTGGGCTAGG - Intergenic
1189313234 X:40034720-40034742 TGCCATTGCAGCAATGGGCTGGG + Intergenic
1189867438 X:45345886-45345908 TAAAAGTGCAGCATTGGTCTGGG + Intergenic
1192267928 X:69552706-69552728 TAGGATTGCACAATTGGGCTGGG + Intergenic
1193260079 X:79395378-79395400 TATCATGGCAGCACTGTGCCAGG - Intergenic
1194127668 X:90040229-90040251 TTTCATTGCAGCATTGTGTCTGG + Intergenic
1198981141 X:142398198-142398220 TATCATGGCAGCATGGGTTTTGG + Intergenic
1202259688 Y:22957506-22957528 TAACATTACAGCATAGAGCTTGG + Intergenic
1202412674 Y:24591250-24591272 TAACATTACAGCATAGAGCTTGG + Intergenic
1202458106 Y:25078820-25078842 TAACATTACAGCATAGAGCTTGG - Intergenic