ID: 1001206975

View in Genome Browser
Species Human (GRCh38)
Location 5:169773086-169773108
Sequence TCAGATCTCCAGAGTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001206975 Original CRISPR TCAGATCTCCAGAGTGTGGA AGG (reversed) Intronic
900083346 1:875238-875260 TCAGCCCTCCAGAGTGGGGCAGG - Intergenic
900308008 1:2020208-2020230 TCAGATCCCCAGAGAGGAGATGG - Intronic
900469832 1:2848286-2848308 TCAGCTCTGCAGAGAGGGGAGGG - Intergenic
901653546 1:10756363-10756385 TCAGGTCTCCAGAGTGTTCCTGG + Intronic
904279687 1:29410050-29410072 TGACATCTCCACAGTGAGGAGGG + Intergenic
905899451 1:41571648-41571670 AAAGAACTACAGAGTGTGGAGGG + Intronic
906204072 1:43977977-43977999 GCAGACCTCCAGAGTGAAGATGG + Exonic
910026979 1:82667078-82667100 TGAAATCCCTAGAGTGTGGAAGG - Intergenic
910845593 1:91601917-91601939 TCAGCACTCCAGGGTTTGGAGGG - Intergenic
918655961 1:187027101-187027123 TCTGATCCCAAGAGGGTGGATGG - Intergenic
919105154 1:193140393-193140415 ACATATCCCCAGAGGGTGGATGG - Intronic
919161295 1:193834242-193834264 TCAGATCTCTAGAGAGCAGAGGG - Intergenic
919762771 1:201108638-201108660 TCTGAGCTCCTGAGTGTGGAAGG - Intronic
920589911 1:207207380-207207402 TCAAATCTCCAGTGTGTGCTGGG - Intergenic
921808102 1:219478992-219479014 TCAAATCTCCTTAGTCTGGAAGG - Intergenic
923473733 1:234314050-234314072 GCTGATGTCCAGAGAGTGGAAGG + Intronic
924047045 1:240042379-240042401 GGAGAGCTCTAGAGTGTGGATGG - Intronic
924170235 1:241331783-241331805 TCAGATATCCAGAGTTAGGGAGG + Intronic
1064930242 10:20617436-20617458 TCACAACTCCACAGTGTGCAAGG + Intergenic
1070571876 10:77646185-77646207 TAAGATCTCAGGAGTGGGGAGGG - Intergenic
1070848348 10:79542108-79542130 TCTGATCTCCAGCCTGGGGAGGG + Intergenic
1070925437 10:80218061-80218083 TCTGATCTCCAGCCTGGGGAGGG - Intergenic
1072594934 10:96862625-96862647 TCCCTTCTCCAGAGTTTGGAAGG + Intronic
1072951230 10:99848389-99848411 GCAGAACTTCAGTGTGTGGAAGG - Intronic
1073103725 10:101020586-101020608 TCAGATCTCCCAAGGTTGGAGGG - Intronic
1075031013 10:119024933-119024955 TGAGATCTCCAGGGTGAGAATGG + Intergenic
1076272039 10:129162174-129162196 TCAGTTGTCCAGTGTGTGGAAGG + Intergenic
1076704580 10:132294158-132294180 TGAGATCACCAGCGTGTGGGTGG + Intronic
1076798047 10:132808290-132808312 GCAGCTTTCCAGAGTGGGGATGG - Intergenic
1078265236 11:9750606-9750628 TCAGCTCTGCAGAGTTTGGAGGG + Exonic
1080034194 11:27695076-27695098 TCAGATCTTGTGAGTGTGTATGG - Intronic
1080082034 11:28232874-28232896 TTAGATATTCAGAGTGTGGGTGG - Intronic
1081359199 11:42152458-42152480 TCAGATCTCCAGCTTGTAGAGGG + Intergenic
1082088650 11:48070579-48070601 TCTCATCTCCATAGTGTGGGTGG + Intronic
1083814471 11:65124846-65124868 CCTGATCTCAATAGTGTGGATGG - Intronic
1083896093 11:65620541-65620563 TCAGATCTGCAGGGAGAGGATGG + Intronic
1084392150 11:68884460-68884482 GCAAATCTTCAGAGGGTGGAAGG - Intergenic
1085399691 11:76228393-76228415 CCAGATCTCCAGAGCCAGGATGG + Intergenic
1087216194 11:95497700-95497722 AAAGATCTCTAGGGTGTGGATGG + Intergenic
1088189872 11:107216577-107216599 TCAGATCTCCAGCGTAATGATGG - Intergenic
1088527640 11:110773965-110773987 TCAGATCTTGGGAGTGGGGATGG + Intergenic
1088568548 11:111198400-111198422 TGAGATGTTCAGAGTATGGAAGG - Intergenic
1088779827 11:113123558-113123580 GCACATCTCCAGAGAGAGGATGG - Intronic
1091727248 12:2854780-2854802 TCAGATGGCCAGAGCGGGGAAGG + Intronic
1092909214 12:13131520-13131542 GCACAGCTCCAGGGTGTGGAAGG - Intronic
1093440325 12:19187647-19187669 TCAGATCTTTTTAGTGTGGAAGG + Intronic
1099801332 12:87460447-87460469 TCAAATCTTCAGAGGGTGAAAGG - Intergenic
1100339370 12:93663598-93663620 TCAGGTCTCCAGTTTGTGAATGG + Intergenic
1100426989 12:94496830-94496852 TCAAATCTTTGGAGTGTGGAAGG - Intergenic
1100505919 12:95220090-95220112 ACAGATCACAAGTGTGTGGATGG + Intronic
1101045828 12:100804830-100804852 TCTGATCTCCAGAGTCTACAAGG - Intronic
1101591456 12:106129003-106129025 TCAGCTCTGCAGAGTGTGCAAGG - Intronic
1103696449 12:122819632-122819654 TCAGAACTCCACCGTGTGGGTGG - Intronic
1105506006 13:21010313-21010335 TCAGATCTGCAGGGTGTGTGGGG - Intronic
1106666720 13:31859151-31859173 TCAGTGCTCCACAGTGGGGAAGG - Intergenic
1107836780 13:44418031-44418053 TGAGAGCTCTGGAGTGTGGAGGG + Intergenic
1110697098 13:78503984-78504006 TCAGAAGTCCAGACTGTCGATGG - Intergenic
1111135705 13:84039540-84039562 TCAGAGCTCCACACTATGGAGGG + Intergenic
1113813310 13:113154763-113154785 TCTGATGTCCACATTGTGGATGG - Intergenic
1116393795 14:44423737-44423759 ACAGTTCTGCATAGTGTGGAAGG + Intergenic
1117355393 14:54919163-54919185 TTAGATTTCAAGTGTGTGGAGGG - Intergenic
1117901036 14:60533618-60533640 TCAGAGCTTGAGAGAGTGGAGGG - Intergenic
1122044553 14:99014091-99014113 TCAGATCTCGAGTGAGGGGATGG - Intergenic
1124208158 15:27740822-27740844 TCAGATCTGCTGACTGTGTAGGG - Intergenic
1125038396 15:35154009-35154031 CTAGATCTCCAGAGAGAGGAAGG + Intergenic
1126064264 15:44813381-44813403 TCACATTTCCAGAGTGAGAAAGG - Intergenic
1127539087 15:59919648-59919670 TCAGTTCTCCAGAGGTTGAAAGG + Intergenic
1129956657 15:79643288-79643310 TCATATCTCCACATGGTGGAAGG - Intergenic
1131310921 15:91289289-91289311 TCAGATCACCAGACTTAGGAAGG - Intronic
1135229374 16:20691338-20691360 TCAGGTCACCAGAATTTGGAAGG + Intronic
1137628026 16:49921818-49921840 TCAGGTCACCAGATTGGGGAGGG - Intergenic
1139396463 16:66643685-66643707 TCAGAATTCCAGGGTGTGTAGGG + Intronic
1139972855 16:70787042-70787064 TGAGGGCTCCAGCGTGTGGAAGG + Intronic
1140038619 16:71390295-71390317 TCAGAACTCCTGTGTGTGGAAGG + Exonic
1140398715 16:74651963-74651985 ACAGCTCTGCAGAGTATGGAGGG - Exonic
1142674732 17:1506783-1506805 CCAGATCTCGAGAGAGTGGGAGG - Intronic
1143028319 17:3953692-3953714 GCAGAGCTCCCGAGTGAGGAAGG - Exonic
1144533140 17:16059712-16059734 TCAGAGCTCCAAAGGGTGCATGG + Intronic
1146558607 17:33848782-33848804 GCAGAACCCCAGAGTGTTGAGGG - Intronic
1149614912 17:57988868-57988890 TCAGATCCTCTCAGTGTGGAGGG + Intergenic
1152193453 17:78902560-78902582 TCAGCTCTCCAGGGTGGAGATGG + Intronic
1154096249 18:11417826-11417848 TCAGAACTCCCGAGTCTAGATGG - Intergenic
1155769393 18:29677807-29677829 TCTAATATCCAGAGTGTGTAAGG + Intergenic
1156147706 18:34205750-34205772 TCATATTCCCAGAGTGAGGAGGG - Intronic
1157807906 18:50672117-50672139 TCAGGTCTCCATAGTGCAGATGG + Intronic
1160048154 18:75406864-75406886 TGTGATGTCCAGTGTGTGGATGG + Intergenic
1160490960 18:79336254-79336276 CCACCACTCCAGAGTGTGGACGG - Intronic
1161770469 19:6228178-6228200 TGCGTGCTCCAGAGTGTGGAGGG - Intronic
1165428083 19:35756569-35756591 TCAGCTCTCCAGAGAATGGAAGG - Intronic
925381722 2:3432610-3432632 TCAGAACTCCCGAGCGTTGATGG + Intronic
925909980 2:8567445-8567467 GCAGATCCACAGCGTGTGGAGGG - Intergenic
929520791 2:42648614-42648636 TCAGATCTCTAGAGTTTGTTAGG - Intronic
930149278 2:48041939-48041961 TCTGATATCCAGAGTCTGCAAGG - Intergenic
933071547 2:77864737-77864759 TCAAACCTTCAGAGGGTGGAAGG + Intergenic
934698105 2:96415015-96415037 TCAAATCTTCAGAGAGTAGAAGG + Intergenic
934980058 2:98832240-98832262 TAAGATCTCCAGGCTGTGCATGG - Intronic
935795772 2:106640426-106640448 TCAGATGTCCCGAGTGGGGCAGG - Intergenic
937060103 2:118974645-118974667 TCAGAGGTCCAGACTCTGGAGGG - Intronic
939673917 2:145048128-145048150 TCAGATTTCCAGAGTTGAGATGG + Intergenic
941859032 2:170259827-170259849 TCAAATATCCAGAATGTGTAAGG + Intronic
943220397 2:185096596-185096618 TTTGATCTAAAGAGTGTGGAAGG + Intergenic
944636115 2:201677714-201677736 TCAGATCCTCAGAGAGGGGAGGG + Intronic
945774118 2:214083163-214083185 TCAGATTTCCATAGAGGGGACGG + Intronic
946196360 2:218034815-218034837 GCAGCGCTCCAGAGTGGGGAGGG - Intergenic
946200619 2:218068870-218068892 GCAGCGCTCCAGAGTGGGGAGGG - Intronic
946989206 2:225308917-225308939 TCAGATCAACAAAGTGTGCAGGG + Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
947986967 2:234456516-234456538 TCACACCTTCAGAGAGTGGAAGG - Intergenic
1170652713 20:18257364-18257386 TCAGATCTGGAGAGTGGGGAGGG - Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1172501532 20:35431666-35431688 TCACATCCCCAGAGTCTGGGTGG + Intergenic
1173270623 20:41531488-41531510 TCTAGTCTCCAGTGTGTGGATGG - Intronic
1174045155 20:47728029-47728051 TCGGATCCCCACAGTGGGGAAGG + Intronic
1174091980 20:48056539-48056561 TCAGATAACTAGAATGTGGAAGG - Intergenic
1175275037 20:57762586-57762608 GCAAATCTCCAGAGGGAGGAAGG - Intergenic
1177484592 21:21740825-21740847 ACAGATCTCCAGAGTCTGCGAGG + Intergenic
1179352576 21:40626542-40626564 TCAGATCACCAGAGGCTGGGAGG - Intronic
1181470579 22:23136876-23136898 TAAGATCTGCAGAGTGAGGCTGG + Intronic
949252374 3:2002042-2002064 TAAGAACTCCAGAGTGTGGGAGG - Intergenic
952523157 3:34182851-34182873 TCACATCTCCAGAGTGAGAAAGG + Intergenic
953971472 3:47351864-47351886 TGAGATCACCAGAGTGAGCATGG + Intergenic
956019934 3:64923458-64923480 TCAGTCATCCACAGTGTGGAGGG - Intergenic
956425887 3:69134642-69134664 TGAGATGTCCAGAATGCGGAGGG + Intergenic
958479244 3:94626207-94626229 TCAGAGCCCTAGAGTGAGGAGGG - Intergenic
966921272 3:184613189-184613211 TCTGATACCCAGAGTGTGGATGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967124842 3:186414124-186414146 TTAGGTCTCCAGAGGCTGGATGG - Intergenic
967485754 3:190028431-190028453 TCAGGTCTCCAGAGTTTGGCTGG - Intronic
972665763 4:41163745-41163767 TCACATGCCCAGAGTATGGAAGG - Intronic
975468679 4:74738238-74738260 TGAAATCTCCAGAGTGTTGGTGG + Intergenic
979576202 4:122294474-122294496 TCAGAACACTAGAGTCTGGAGGG + Intronic
982132958 4:152247002-152247024 TAAGAACTACGGAGTGTGGAAGG + Intergenic
983355583 4:166653099-166653121 TGAAATTTCCAGTGTGTGGATGG + Intergenic
984848691 4:184131902-184131924 CTAGATCTCCAGCTTGTGGATGG - Intronic
987080819 5:14423807-14423829 CCAGATGTCCTGAGTGGGGAGGG - Intronic
988475371 5:31580262-31580284 TCAAATCTCCTGGGTATGGAGGG + Intergenic
988698505 5:33648765-33648787 TCAGATCTCCAGCATGCTGAAGG - Intronic
989791416 5:45407025-45407047 TCAGCACTCCAGAGTATGAAAGG + Intronic
990208127 5:53452138-53452160 TCATTTCTCCAGAGAGTAGATGG - Intergenic
990967456 5:61464615-61464637 TGAGAGCTCCAGAGTGTGGGTGG + Intronic
995012479 5:107273242-107273264 TCAGATATTCAGAATGTGGTTGG + Intergenic
996076150 5:119197071-119197093 TCAGTACTCAAGAGTATGGATGG + Intronic
1000010528 5:157227220-157227242 TCAGAGGTCCAGAGAGTAGAAGG + Intronic
1001183797 5:169547441-169547463 TCAGTTATACAGAGTCTGGAGGG + Intergenic
1001206975 5:169773086-169773108 TCAGATCTCCAGAGTGTGGAAGG - Intronic
1005743645 6:28815783-28815805 TCAGAACTGCTGAGTATGGATGG - Intergenic
1006389206 6:33748745-33748767 TCCCATCTCCACTGTGTGGATGG + Intergenic
1007253022 6:40509339-40509361 TCAGAACTACTGAGTGTGAAAGG - Intronic
1007769143 6:44179572-44179594 TCAGATCTCTAGGGTGGTGAAGG - Intronic
1010496436 6:76538149-76538171 TTAGATCTCGGGAGGGTGGAGGG + Intergenic
1011436201 6:87339866-87339888 TGAGATGTCCAGGGTGTAGATGG + Intronic
1013015770 6:106159491-106159513 TCTGATCTGCAGTGTGGGGAAGG + Intergenic
1013550978 6:111207754-111207776 TCACACCTCCACAGTGTGGGAGG - Intronic
1018166400 6:161101608-161101630 TTAGAGCTCTAGAGTCTGGAAGG - Intronic
1021027496 7:15686935-15686957 CCAGGCCTCCAGAGTCTGGAGGG - Intergenic
1021519033 7:21520037-21520059 TCAGACTTCCAGTATGTGGATGG + Intergenic
1023345875 7:39270760-39270782 ACACATCTCTAGAATGTGGATGG + Intronic
1024006835 7:45230924-45230946 TCAGGTCTGCAGAGTGTTGTGGG + Intergenic
1029856903 7:103526676-103526698 TCAGAGCTCCACTGTGTGAAGGG + Intronic
1030669456 7:112319189-112319211 TCAGACCTCCAGAGAGGGGAGGG - Intronic
1031011042 7:116525685-116525707 GCAGAGCTCCAGCGCGTGGAGGG - Intronic
1033545130 7:142392700-142392722 ACAGATCTCCGGAGTGAGGAGGG - Intergenic
1035083103 7:156233655-156233677 TCAGGTCCCCAGAGCTTGGAGGG + Intergenic
1035931082 8:3780866-3780888 TGAGATTTGCAGAGTGTGGAAGG + Intronic
1039801065 8:40954788-40954810 GCAGATCTCCAGAGGAGGGAGGG - Intergenic
1043885584 8:85596180-85596202 TCAGATCTCCTAAGTGGAGATGG - Intergenic
1045379879 8:101612449-101612471 TAGCATCTTCAGAGTGTGGATGG + Intronic
1046453885 8:114433177-114433199 CCATTTCTCCAGATTGTGGAGGG + Intergenic
1053854154 9:42320572-42320594 TCACTTCTCCAGAGTGGGCATGG - Intergenic
1055010923 9:71564201-71564223 TGGGCTTTCCAGAGTGTGGAGGG - Intergenic
1055253635 9:74338897-74338919 TCAGTTCTCCAGGGTAAGGAGGG - Intergenic
1055982098 9:82014205-82014227 TGACATCTGGAGAGTGTGGAGGG + Intergenic
1056496589 9:87161390-87161412 TCACTTCTCCAGATTGTGAAAGG - Intergenic
1056792586 9:89635673-89635695 GCAGATCACCCGAGGGTGGAAGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059257645 9:112945649-112945671 TCAGATCTGCAGAGAATGGGAGG + Intergenic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060121830 9:120998788-120998810 TCAGTTCACCAGAATTTGGAGGG - Intronic
1060230401 9:121821471-121821493 CAAGCTCTCCAGAGTGTGGTTGG - Intergenic
1062605259 9:137344772-137344794 GGAGATCTCCAGACAGTGGAAGG - Intronic
1062605269 9:137344860-137344882 GGAGATCTCCAGACAGTGGAAGG - Intronic
1062605279 9:137344948-137344970 GGAGATCTCCAGACAGTGGAAGG - Intronic
1185523810 X:761442-761464 TAAGCTCCCCAGACTGTGGAAGG - Intergenic
1186264398 X:7816530-7816552 TAATATCTACAGAGTGTTGACGG + Intergenic
1186307405 X:8277366-8277388 TCAGATGTCTAAAGTGGGGAAGG - Intergenic
1187363210 X:18646700-18646722 TGATACCTCCAGGGTGTGGATGG - Intronic
1188603502 X:31998946-31998968 TCATGTCTCCAGTGTATGGATGG - Intronic
1190735923 X:53256053-53256075 TCTCATCCCCACAGTGTGGAGGG - Exonic
1190759987 X:53431164-53431186 TCAGAGCTCCAGGGTGGGGTGGG - Intergenic
1193759964 X:85452617-85452639 TTAAATCTCCAGAGTGGGGAGGG + Intergenic
1196132442 X:112171972-112171994 TCTGATATCCAGAGTGTAGAAGG + Intergenic
1196294026 X:113978604-113978626 TCAGAGGTTCAAAGTGTGGAGGG - Intergenic
1196488138 X:116237944-116237966 ACAGATGTCAAGAGTGTGCAAGG + Intergenic
1196623163 X:117847476-117847498 TCAGATCACCAGAGTTGGAAAGG + Intergenic
1199812545 X:151365135-151365157 TCAGATCACCTGGGTGTGGGAGG - Intergenic
1201739562 Y:17308971-17308993 TCTAATCTCCACAGTGTAGAAGG - Intergenic