ID: 1001207763

View in Genome Browser
Species Human (GRCh38)
Location 5:169779981-169780003
Sequence TCTGGGTCACCGAAGCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001207755_1001207763 21 Left 1001207755 5:169779937-169779959 CCGTTGCATTTGCCCTCCCAGAG 0: 1
1: 0
2: 3
3: 19
4: 231
Right 1001207763 5:169779981-169780003 TCTGGGTCACCGAAGCAGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 71
1001207757_1001207763 8 Left 1001207757 5:169779950-169779972 CCTCCCAGAGAGAGCTCTAACCA 0: 1
1: 1
2: 1
3: 11
4: 115
Right 1001207763 5:169779981-169780003 TCTGGGTCACCGAAGCAGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 71
1001207758_1001207763 5 Left 1001207758 5:169779953-169779975 CCCAGAGAGAGCTCTAACCAGTT 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1001207763 5:169779981-169780003 TCTGGGTCACCGAAGCAGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 71
1001207759_1001207763 4 Left 1001207759 5:169779954-169779976 CCAGAGAGAGCTCTAACCAGTTT 0: 1
1: 0
2: 1
3: 14
4: 114
Right 1001207763 5:169779981-169780003 TCTGGGTCACCGAAGCAGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 71
1001207754_1001207763 22 Left 1001207754 5:169779936-169779958 CCCGTTGCATTTGCCCTCCCAGA 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1001207763 5:169779981-169780003 TCTGGGTCACCGAAGCAGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 71
1001207756_1001207763 9 Left 1001207756 5:169779949-169779971 CCCTCCCAGAGAGAGCTCTAACC 0: 1
1: 0
2: 2
3: 14
4: 139
Right 1001207763 5:169779981-169780003 TCTGGGTCACCGAAGCAGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001207763 Original CRISPR TCTGGGTCACCGAAGCAGTA AGG Intronic
900369468 1:2324893-2324915 TCTGGGTCAGGGAAGCAGGTGGG + Intronic
900406003 1:2493282-2493304 TCTGGGTCACTGCAGCATTTTGG + Intronic
901137922 1:7009659-7009681 TCTGGGGGACAGAAGCAGCAGGG - Intronic
901232282 1:7647839-7647861 TCTGGGTGGCCGAGGCAGGAGGG + Intronic
904522000 1:31102800-31102822 CCTGGGTCTCTGAGGCAGTATGG - Intergenic
907068997 1:51518133-51518155 TTTGGGTCACAGGAGCAGGAAGG + Intronic
911498963 1:98662199-98662221 TCTGTGTCAGAGAAGCAGAAAGG - Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916210917 1:162359258-162359280 TGTGGGACACAGATGCAGTATGG - Intronic
924584608 1:245350968-245350990 TCCTGGTCACCAAAGCAGTGAGG + Intronic
1070662288 10:78315943-78315965 TCTGGGTCTTTGAAGCAGGAAGG - Intergenic
1074890283 10:117730082-117730104 TATGGGTCAGCTAAGCAGCAGGG + Intergenic
1084034407 11:66499734-66499756 GCTGTGTCACCCAAGCAGGAGGG - Intronic
1084183221 11:67456731-67456753 TCTGGGCCAGCGAGGCAGGAAGG - Intronic
1091383410 12:77489-77511 TGGGGGTCACCGCAGCAGGAGGG + Intronic
1091877899 12:3951839-3951861 TCTGGGGCACCGCTGCAGTTCGG + Intergenic
1093758893 12:22882856-22882878 CCTGGGTCTCCGTAGTAGTATGG + Intergenic
1122753684 14:103959423-103959445 TCTGGAGCACTGAAGAAGTAAGG + Intronic
1125174563 15:36805868-36805890 TTTGGGTGACAAAAGCAGTAAGG - Intronic
1126836335 15:52669841-52669863 TCTGGGTCATGGAAGCAGAAGGG + Intronic
1127886162 15:63202851-63202873 TCTGGATCACAGAGGCATTATGG - Intronic
1131194657 15:90345917-90345939 TCTGTGTGACCAAAGGAGTATGG + Intergenic
1138460315 16:57143994-57144016 TCTGGGACACCTAAGCAGATAGG - Intronic
1140408631 16:74727516-74727538 TCTTGATCACTGAAGCAGGAGGG - Intronic
1148322297 17:46764806-46764828 TATGAGTCACAGGAGCAGTAAGG + Intronic
1151982581 17:77522268-77522290 TCTGGCTCAGTGAAACAGTAGGG - Intergenic
1152346352 17:79754627-79754649 TTTGGGTCACTGTAGCAGGACGG - Intergenic
1161879927 19:6941905-6941927 TCTGAGTCACCTAAGCAGTTAGG + Intergenic
1167495081 19:49812922-49812944 TCTGGGTCTTCAAGGCAGTAGGG - Intronic
934742786 2:96737912-96737934 TCTGGGTCACCAACACAGGAGGG + Intronic
936291528 2:111228023-111228045 TATGGGTCACAGCAGAAGTACGG - Intergenic
937686173 2:124699605-124699627 TATGGGTTACTGAAGCAGTGAGG - Intronic
939767771 2:146273601-146273623 CCTGGGTCACTAAAGCACTATGG - Intergenic
948875199 2:240822761-240822783 TCAGGGGCACCCAAGGAGTATGG + Intergenic
1168825427 20:810071-810093 TCTGGCTTAGCGAAGCAATAGGG - Intergenic
1173324743 20:42022538-42022560 TCAGAGTCACAGAACCAGTAGGG - Intergenic
1176281768 20:64317298-64317320 TGGGGGTCACCGCAGCAGGAGGG - Intergenic
1184751502 22:46488987-46489009 TTGGGGTCACCGTGGCAGTAAGG + Intronic
1184843864 22:47068990-47069012 TGTGGCTCACTGAGGCAGTAGGG + Intronic
953563970 3:44015313-44015335 TCTGGGTCTCCGAGGCAACATGG - Intergenic
956934960 3:74090025-74090047 TCTGGGAAACAGAAGCAGTTTGG - Intergenic
960460250 3:117925414-117925436 TCTGGGTCACCCCAGAAGTCTGG + Intergenic
961075467 3:123977919-123977941 TGTGGGTCACCAATGCAGCATGG + Intronic
961308219 3:125974597-125974619 TGTGGGTCACCAAAGCAGCATGG - Intronic
969409987 4:7021857-7021879 TCAGGCTCACAGAAGCAGGACGG - Intronic
973264944 4:48201606-48201628 CGTGGGCTACCGAAGCAGTAGGG + Intronic
977004646 4:91549850-91549872 ACTGGCTCACCGAAGGACTAAGG - Intronic
978282579 4:107035717-107035739 CCTGGGTCCCCGAACCAGGAAGG - Exonic
981416508 4:144500085-144500107 TCTGGGCCACCAAAGCAACAAGG - Intergenic
983979207 4:173973484-173973506 TCTGGGACAGCAATGCAGTATGG + Intergenic
985167223 4:187109562-187109584 TCTGGGTCCCAGGAGCAGTTGGG + Intergenic
989494028 5:42090533-42090555 TCTGGGTCACTGAAGAAGACTGG - Intergenic
994277434 5:97855587-97855609 GCTGAGTCACCCAAGCAGCACGG - Intergenic
994744096 5:103657483-103657505 ACTGGGTCACAGATGCAATAAGG + Intergenic
1001207763 5:169779981-169780003 TCTGGGTCACCGAAGCAGTAAGG + Intronic
1001415679 5:171543509-171543531 CCTCGGTCACCGCAGCAGAACGG + Intergenic
1002714661 5:181219487-181219509 TCGGGGTCACAGAGGCAGCAAGG - Intergenic
1011237883 6:85237795-85237817 TCTGACCCACAGAAGCAGTAAGG + Intergenic
1013433473 6:110077580-110077602 TCGAGGTCACCTAAGTAGTACGG - Intergenic
1017334362 6:153237835-153237857 CCTGGGGCACGGAAGCAGTCAGG - Intergenic
1018978935 6:168587614-168587636 TCTGGCTCAGTGAAGCAATAGGG + Intronic
1020639313 7:10735699-10735721 TCTAGGTAGCCGAAGCAGAAAGG - Intergenic
1034005012 7:147462071-147462093 TCTGGGTCACGAGAGCAGTGTGG - Intronic
1034544426 7:151780748-151780770 TCAGGCTGACCAAAGCAGTATGG + Intronic
1038581428 8:28752243-28752265 TTTGGGTCACGGTGGCAGTAGGG + Exonic
1039962921 8:42263399-42263421 TCTGGGTCACCGAAACTGTAGGG + Intergenic
1041298449 8:56386614-56386636 TCTGGGTCACAGCATCAGTGAGG + Intergenic
1049466034 8:142751715-142751737 CCGGGGTCACCGGAGCAGGAGGG - Intronic
1050165564 9:2761261-2761283 TCTGAGACACTGAAGCAGTATGG - Intronic
1052743756 9:32419069-32419091 GCTGGGTCAGCCAATCAGTATGG + Exonic
1057221040 9:93257916-93257938 TCCGGGTCACCGAAGCCCTCGGG - Intronic
1061406971 9:130397718-130397740 TCTGAGTCACCCCAGCTGTAGGG + Intronic
1062711117 9:137975669-137975691 TCTGGGTCTCAGAGGCACTAGGG + Intronic
1189321871 X:40091928-40091950 GCTGGGGCACCGAGGCAATAAGG + Intronic
1191883127 X:65862135-65862157 TGTGGGTCAGCGTAGCAGCATGG + Intergenic
1197213760 X:123849225-123849247 TCTGGCTTAGTGAAGCAGTAGGG - Intergenic
1198233233 X:134713631-134713653 TCTTGGTCATAAAAGCAGTAAGG + Intronic