ID: 1001209035

View in Genome Browser
Species Human (GRCh38)
Location 5:169793196-169793218
Sequence CTGTGTAAGCATATGCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001209035_1001209037 6 Left 1001209035 5:169793196-169793218 CCAAAATGCATATGCTTACACAG 0: 1
1: 0
2: 0
3: 21
4: 222
Right 1001209037 5:169793225-169793247 AGCACATCTAATCCATCAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001209035 Original CRISPR CTGTGTAAGCATATGCATTT TGG (reversed) Intronic
900802240 1:4744612-4744634 GTGTGTGTGCATATGCATGTGGG - Intronic
903197120 1:21699032-21699054 CTGTGCATGTACATGCATTTGGG - Intronic
904102014 1:28038797-28038819 CAGAAAAAGCATATGCATTTTGG + Intronic
904113169 1:28142676-28142698 CTCTCTAAGCATCTGTATTTTGG + Intergenic
904800945 1:33092646-33092668 CTGCGTAAGCAAATGCATTGAGG + Intronic
904843031 1:33386148-33386170 CTTTGTAAGGGTATGCATTTTGG + Intronic
905008472 1:34730193-34730215 CTGTGTATGCACATCTATTTGGG - Intronic
906785953 1:48616085-48616107 CAGTTTCAGCATATGGATTTTGG + Intronic
908890737 1:68844650-68844672 CTGTGTCAGCATCTGCTTCTGGG - Intergenic
909296461 1:73955183-73955205 CTATATATGCATATGCAGTTTGG + Intergenic
909940636 1:81607678-81607700 CTATGTAACTATATGCATTTTGG + Intronic
910342614 1:86204922-86204944 GTGTGTAAGCATATGTGTGTGGG - Intergenic
911266380 1:95749497-95749519 CTGTGTGAGCAGAGTCATTTAGG - Intergenic
913448333 1:118973591-118973613 CTGTGGAAGCCTAAGAATTTGGG + Intronic
913966357 1:143380648-143380670 CTTTATAAGAATTTGCATTTTGG - Intergenic
914060730 1:144206255-144206277 CTTTATAAGAATTTGCATTTTGG - Intergenic
914118420 1:144760114-144760136 CTTTATAAGAATTTGCATTTTGG + Intergenic
918964028 1:191317973-191317995 ATGTGTGAGCATATGCATCAAGG + Intergenic
919116435 1:193285853-193285875 ATTTGGAAGCACATGCATTTTGG + Intergenic
919202661 1:194377205-194377227 TTGTTTGAGCATATTCATTTTGG + Intergenic
919327788 1:196131173-196131195 CTTGGTAAGCATTTGCAATTTGG + Intergenic
919614612 1:199790419-199790441 CTGTGTATGCATATGCTATATGG + Intergenic
922476125 1:225907927-225907949 GAGTTTAAGCATATGAATTTTGG - Intronic
922743562 1:228030468-228030490 CTGGGTCAGCATATGCATGGTGG - Intronic
923996157 1:239496887-239496909 CTGTGTATGCATATACACATAGG - Intronic
1063356203 10:5400708-5400730 CTGAGTAAGCCTCTACATTTGGG + Intronic
1063394698 10:5676168-5676190 TTGGGTAAGCATGTGCCTTTTGG + Intergenic
1066178972 10:32941226-32941248 ATTTCTAAGCATATGCATTTGGG + Intronic
1067260166 10:44682639-44682661 CAGTGCTAGCATCTGCATTTGGG - Intergenic
1068811937 10:61265945-61265967 ATCTGTAATCATATGTATTTGGG - Intergenic
1068914814 10:62418693-62418715 CTGTTTAAGCATATTCATCTTGG + Intronic
1071264559 10:83953425-83953447 CTGAGTCAGAATGTGCATTTAGG - Intergenic
1073928871 10:108550582-108550604 ATTTGAAAGCAGATGCATTTTGG - Intergenic
1074600435 10:114908258-114908280 CAGTTTCAGCATATGAATTTTGG + Intergenic
1075054742 10:119208859-119208881 CCATGTAAACATATGTATTTAGG + Intronic
1077281232 11:1747173-1747195 CTGTGTAAGCACCTGCCCTTGGG + Intronic
1078949126 11:16108855-16108877 CAGTGTAAGCAAATACATTTAGG - Intronic
1078986940 11:16606438-16606460 CTGTGAAAGCAAATGCGTGTCGG - Intronic
1079385807 11:19978337-19978359 CTGTGAAAGCATATGATGTTTGG + Intronic
1079519655 11:21311429-21311451 CTTTGAAGGCATATGTATTTTGG + Intronic
1080382838 11:31791704-31791726 CTCTCTGAGCATATGGATTTTGG - Intronic
1081746567 11:45477177-45477199 ATGTGTAAGCATTGTCATTTTGG + Intergenic
1081823889 11:46027503-46027525 CTGTGCAGGCATCTGCATTCAGG - Intronic
1081994769 11:47356308-47356330 ATGTGTAAGCAGATGCAGTGTGG - Intronic
1082188494 11:49212711-49212733 CTGTATAAAAATAAGCATTTTGG - Intergenic
1082861561 11:57861786-57861808 CTGAATAAGAATCTGCATTTTGG - Intergenic
1085153562 11:74272161-74272183 GTGTGCATGCATGTGCATTTGGG - Intronic
1085845661 11:80061686-80061708 CTATGTGAGCATATGCAATGGGG + Intergenic
1086075947 11:82852389-82852411 CAGTGTATACATATGCTTTTGGG - Intronic
1087435181 11:98107089-98107111 TTGTGTATGAATATACATTTAGG - Intergenic
1088718008 11:112565712-112565734 GTCTTTAAGCATGTGCATTTCGG - Intergenic
1093006460 12:14056980-14057002 GTGGTTAAGAATATGCATTTTGG - Intergenic
1093378792 12:18464396-18464418 AGGTTTCAGCATATGCATTTGGG + Intronic
1095088890 12:38086247-38086269 CTGTGTCAGCAAAGGCCTTTAGG + Intergenic
1095130272 12:38533810-38533832 CTAGGTATGCATAAGCATTTTGG + Intergenic
1097318582 12:58200766-58200788 CTGTGTCAAAACATGCATTTTGG - Intergenic
1097485583 12:60194665-60194687 CTGTATAAACACATACATTTAGG + Intergenic
1098655669 12:73026755-73026777 CTGTTTAAGCAGAAGCATTTAGG + Intergenic
1098925505 12:76345534-76345556 CTGTGTTAGCCTATGTGTTTAGG - Exonic
1099419059 12:82430021-82430043 CTTTGTAAGAAAATGCAATTGGG - Intronic
1104928092 12:132324141-132324163 CTGCGTAAGCGTTTCCATTTTGG - Intronic
1105564137 13:21526533-21526555 TTCTGTAAACATCTGCATTTTGG - Intronic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1110328624 13:74246092-74246114 ATGTTGAAGCATAGGCATTTGGG - Intergenic
1111279511 13:86001845-86001867 ATGTGTAAGAATCTGCATGTTGG + Intergenic
1112679943 13:101752596-101752618 CTGCGTAAGCCAATGCAGTTTGG - Intronic
1114263917 14:21059964-21059986 CTCTGTATGTATATGCATATGGG - Intronic
1116177153 14:41486157-41486179 CTCTTAAAGCATTTGCATTTTGG - Intergenic
1117252660 14:53952297-53952319 ATGTGTCTGCATATGCATTTAGG + Intronic
1118328647 14:64799217-64799239 GTGTGTAAGCATATGCACACAGG + Intronic
1118658952 14:67986042-67986064 CTGTGTGTGTATGTGCATTTGGG + Intronic
1118992241 14:70808302-70808324 CTTTGAAAGCAAATGCCTTTAGG + Intronic
1120048414 14:79835781-79835803 CTGTGCAAGTATAAGGATTTAGG + Intronic
1120652919 14:87155957-87155979 TTTTGAAAGGATATGCATTTTGG + Intergenic
1120761207 14:88287156-88287178 CTGTGTCAGATTATGCATTCTGG - Intronic
1120799875 14:88676001-88676023 CTGTGTCATCATCAGCATTTTGG + Intronic
1123672564 15:22674145-22674167 CAGTGTCAACATATGAATTTTGG + Intergenic
1124324614 15:28747434-28747456 CAGTGTCAACATATGAATTTTGG + Intergenic
1125405600 15:39350034-39350056 AAGTGTCAGCATATGAATTTTGG + Intergenic
1127699191 15:61480545-61480567 CTGTGAAAGCAAATGCAGTCGGG + Intergenic
1130865188 15:87927565-87927587 CTGTTTCAACATATGAATTTGGG - Intronic
1133536702 16:6709391-6709413 CTGTGGAAGAATTTGCATTATGG + Intronic
1134512747 16:14861622-14861644 CTGACCTAGCATATGCATTTTGG - Intronic
1134700385 16:16260116-16260138 CTGACCTAGCATATGCATTTTGG - Intronic
1134971441 16:18534545-18534567 CTGACCTAGCATATGCATTTTGG + Intronic
1137018437 16:35398464-35398486 CAGTGTCAACATATGAATTTTGG - Intergenic
1138242345 16:55437250-55437272 CTGTGTGAGTAAATGGATTTAGG + Intronic
1144757640 17:17689620-17689642 GTGGGTATGCATATGTATTTTGG + Intronic
1146655507 17:34632441-34632463 CTGTAAAAGCATTTGCATGTTGG + Intronic
1150634048 17:66900242-66900264 TTGGGTAAGCATATGAATTTGGG - Intergenic
1150889235 17:69126973-69126995 CAGTGCAAGGATAGGCATTTTGG + Intronic
1151145017 17:72032306-72032328 CTGAGAAAGCATATGTGTTTTGG - Intergenic
1152028767 17:77828564-77828586 GTGTGTATGTATATGCATGTGGG + Intergenic
1152028798 17:77828991-77829013 GTGTGCATGCATATGCATGTGGG + Intergenic
1153245793 18:3071888-3071910 ATCTGCAAGCATAGGCATTTTGG + Exonic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1157449884 18:47777931-47777953 TTATGTAAGCATATGTACTTGGG - Intergenic
1157968696 18:52240171-52240193 CTGGTAAAGAATATGCATTTGGG - Intergenic
1158302278 18:56065416-56065438 CTGGGTAAGCATATGGACTCTGG + Intergenic
1159266816 18:66091283-66091305 ATTTGTAATCATATGCATTTAGG - Intergenic
1159471396 18:68860986-68861008 CTGTGTAATCAGATAGATTTGGG + Intronic
1161979455 19:7623045-7623067 GTGTGTGTGCATGTGCATTTGGG - Intronic
1162530406 19:11232773-11232795 CTGTGTAGGTATATGCATGTGGG + Intronic
1162530418 19:11232854-11232876 CTGTGTATGTATATGCATGGGGG + Intronic
1163894253 19:20043658-20043680 CTGTGTAAACAACTGAATTTTGG - Intergenic
1202700138 1_KI270712v1_random:158143-158165 CTTTATAAGAATTTGCATTTTGG - Intergenic
925536526 2:4924039-4924061 CTGTGTAAACATGTACATTTAGG + Intergenic
925796462 2:7550108-7550130 CTGTGAAAGCATTTGCTTCTAGG + Intergenic
925806189 2:7651212-7651234 ATATGTAAGGATATTCATTTAGG - Intergenic
926907789 2:17822128-17822150 ATGGGTAAGCAAATGCACTTGGG + Intergenic
928520343 2:32082354-32082376 ATGTATAAGAATATCCATTTGGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930390685 2:50758348-50758370 TTTTGTTAGCATCTGCATTTGGG - Intronic
930825796 2:55695671-55695693 CTATGTAATCATTTTCATTTGGG + Intergenic
933041217 2:77469157-77469179 CTGCCTAAGCATTTACATTTGGG + Intronic
934171071 2:89541618-89541640 CTTTATAAGAATTTGCATTTTGG - Intergenic
934281376 2:91615936-91615958 CTTTATAAGAATTTGCATTTTGG - Intergenic
935233868 2:101121663-101121685 CTGTTTCAACATATGGATTTGGG + Intronic
935458312 2:103296689-103296711 ATCTTTAAGCTTATGCATTTAGG + Intergenic
938605825 2:132891601-132891623 CTGTGTGTGCATATGCATATGGG + Intronic
939104035 2:137928400-137928422 CAGTTTGAGCATATGAATTTTGG + Intergenic
939661477 2:144896445-144896467 CCATGATAGCATATGCATTTTGG - Intergenic
940560907 2:155295483-155295505 CTGTTTAAACATATGCCTTCAGG - Intergenic
941047998 2:160697996-160698018 GTGTGTATGCGTATGCATTGTGG + Intergenic
941469420 2:165865874-165865896 CTGTATATGCATATGTATGTAGG + Intronic
943358487 2:186889688-186889710 GTGTCTAAGAATATTCATTTGGG - Intergenic
943545931 2:189277840-189277862 CTTTGGCAGTATATGCATTTGGG + Intergenic
945198608 2:207259974-207259996 CTGTGTCTGCATAAACATTTTGG + Intergenic
946320641 2:218952264-218952286 CTCTGTGTGCATATGAATTTAGG + Intergenic
946524697 2:220505873-220505895 CTTTGTAACCACATGAATTTGGG + Intergenic
946839072 2:223801827-223801849 CTCTGTAAGCCTAGGCCTTTTGG - Intronic
946954876 2:224918341-224918363 GTGTGTGAGCATGTGCAATTGGG + Intronic
947688567 2:232113446-232113468 CTGTCTAAGCATATTCATGCAGG - Intronic
948056558 2:235012985-235013007 CTGTGTCACCATCTGCATTTAGG - Intronic
1170934432 20:20797283-20797305 CTGGCTAAGCATATGTATGTCGG + Intergenic
1174456443 20:50652069-50652091 CTGAGGAAGCATTTGCATTTAGG + Intronic
1178095714 21:29212698-29212720 CAGTTTCAGCATATGAATTTAGG - Intronic
1178220953 21:30659386-30659408 CTGGGTAATCATATGCAAATAGG + Intergenic
1181967924 22:26669594-26669616 CTGCTTCAACATATGCATTTGGG + Intergenic
1182966092 22:34522339-34522361 CTGTGGAAGCAATTGCCTTTAGG - Intergenic
1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG + Exonic
951864222 3:27289269-27289291 CTTTCTAAGCACCTGCATTTGGG + Intronic
952808393 3:37378951-37378973 CTCTGCAAGCAGCTGCATTTTGG + Intergenic
953223528 3:40996691-40996713 TTGTGTTTGCATTTGCATTTAGG + Intergenic
956090452 3:65661110-65661132 ATGTGTAAGAATATACATTGGGG - Intronic
956888426 3:73584495-73584517 GTGTGTATGCATATGCGTTGTGG + Intronic
959401444 3:105906948-105906970 CTGTCTAAAAATATGTATTTGGG - Intergenic
960252885 3:115476070-115476092 CTTTGCAACCATAAGCATTTTGG - Intergenic
960922354 3:122760230-122760252 CTGTTTAATCACATGGATTTGGG - Intronic
963087175 3:141448569-141448591 CTGTTTTAGCATCTGTATTTTGG + Exonic
964200784 3:154116601-154116623 CAGAGTAAGAATAAGCATTTTGG - Intergenic
964261610 3:154845308-154845330 CTCTGTATGCATGTGCATTTTGG - Intergenic
964770178 3:160216620-160216642 CTGTGTCACCAAATTCATTTTGG - Intergenic
966999743 3:185322616-185322638 CTGTGTATCCAGATGCCTTTTGG + Intronic
970457276 4:16237681-16237703 ATTTGTAAGCATTTGCATCTGGG + Intergenic
971245349 4:24922187-24922209 CTATTTCAGCATATGAATTTGGG + Intronic
973161747 4:47026766-47026788 CTGTATAATTAAATGCATTTAGG - Intronic
975047487 4:69823714-69823736 CTGTGTAAATATTTGCCTTTCGG + Intronic
976084993 4:81398710-81398732 ATGTGTCTGCCTATGCATTTGGG + Intergenic
976544060 4:86313260-86313282 CTTTTTAAGCATTTACATTTGGG - Intronic
976766893 4:88607191-88607213 GTGTGTATGCATGTGCACTTGGG + Intronic
977518559 4:98052492-98052514 CTGTCTAAGGATATACATATAGG + Intronic
979120020 4:116886534-116886556 ATGTGTAACCATATGGCTTTTGG + Intergenic
980474497 4:133294838-133294860 AAGTGTATGCATATGCATCTCGG - Intergenic
980591334 4:134893294-134893316 CTATGTATACACATGCATTTGGG - Intergenic
980868562 4:138583310-138583332 CTGTGAAACCATCTGGATTTGGG + Intergenic
981228809 4:142328783-142328805 CTGTATAAACATATGCTCTTTGG + Intronic
981516708 4:145618340-145618362 TTGTGTAATGATATGCATTTGGG - Exonic
981543597 4:145871772-145871794 CCCTGTAAGAATATGCATTCTGG + Intronic
982069530 4:151683235-151683257 CTGTGTAAGCACATGCCATCTGG + Intronic
982177371 4:152718631-152718653 CGGTTTCAGCATATGAATTTGGG + Intronic
982734584 4:158992271-158992293 CTCTGTAGTCAAATGCATTTGGG + Intronic
986931617 5:12831120-12831142 GTGTGTACACATATGCATTTAGG - Intergenic
987511312 5:18843710-18843732 ATGTGTAAGGATAAGCATTGAGG - Intergenic
987953626 5:24708108-24708130 GTGTGTATGTATATGTATTTAGG + Intergenic
989082081 5:37633826-37633848 CTGTGTAAGCATGTAGATTTAGG - Intronic
990287191 5:54311468-54311490 ATCTATAAGCAGATGCATTTGGG + Intergenic
992442633 5:76810364-76810386 CTATGGAAGAATAAGCATTTGGG + Intergenic
994615349 5:102097888-102097910 ATGTGTGAGCATTTGGATTTGGG + Intergenic
995226966 5:109711403-109711425 CTTTGATAGCATATGTATTTAGG + Intronic
995787706 5:115847925-115847947 CTGTGAACGTATAAGCATTTGGG - Intronic
996157266 5:120116925-120116947 CTTTTTAAGCATATGCAGATAGG + Intergenic
996260645 5:121463260-121463282 CTGTGCAAGCAACTTCATTTAGG + Intergenic
997452609 5:133995743-133995765 CTGTGTAAAAATGGGCATTTTGG - Intronic
998744224 5:145238484-145238506 ATGTGTAAATAAATGCATTTAGG - Intergenic
1001209035 5:169793196-169793218 CTGTGTAAGCATATGCATTTTGG - Intronic
1002952009 6:1823448-1823470 CTGTGTAAGAACATACAATTGGG - Intronic
1005529141 6:26684964-26684986 CTGTGTCCTCATATACATTTGGG - Intergenic
1005531939 6:26716440-26716462 CTGTGTCCTTATATGCATTTGGG - Intergenic
1005538856 6:26785225-26785247 CTGTGTCCTTATATGCATTTGGG + Intergenic
1005541655 6:26816682-26816704 CTGTGTCCTCATATACATTTGGG + Intergenic
1005673162 6:28127333-28127355 CCCTGTAAGCATATTCATCTTGG - Intronic
1006185639 6:32180188-32180210 CTGTGGAAGCATATGCTCCTAGG - Intronic
1008513425 6:52298084-52298106 CTGTGTGAGCAAAGGCAATTGGG - Intergenic
1008583712 6:52929918-52929940 CTGAATCAGCATCTGCATTTTGG - Intergenic
1009009703 6:57827452-57827474 CTGTGTCCTTATATGCATTTGGG + Intergenic
1009012463 6:57858739-57858761 CTGTGTCCTCATATACATTTGGG + Intergenic
1012824443 6:104129026-104129048 TTGTGTTAGCATTTACATTTGGG + Intergenic
1013375008 6:109506109-109506131 CGGTTTCAGCATATGAATTTTGG + Intronic
1013426731 6:110019051-110019073 GTTTGTAATCAAATGCATTTGGG - Intergenic
1015906323 6:138121013-138121035 CAGTGTCAACATATGAATTTTGG - Intergenic
1017308163 6:152944265-152944287 CTTTTTAAGCATAGGCAATTAGG - Intergenic
1017635951 6:156443250-156443272 CTGTGTAGGCATAGGCAGGTAGG - Intergenic
1017978867 6:159381022-159381044 TTGTTTAAGCTTCTGCATTTTGG + Intergenic
1018403339 6:163448950-163448972 GTGTGTAACCTTATGAATTTAGG - Intronic
1018405030 6:163471427-163471449 CTTTGTACAAATATGCATTTAGG - Intronic
1021148851 7:17124433-17124455 CTGTGAAACTATATGCATTGGGG - Intergenic
1023966678 7:44966490-44966512 GTGTGTGAGCACATGCATGTGGG - Intronic
1024313110 7:47988089-47988111 TTATGTATTCATATGCATTTGGG - Intronic
1024802495 7:53096853-53096875 CTGTGTCAGCATAGGCTTTAAGG - Intergenic
1028107944 7:86902584-86902606 GTATTTCAGCATATGCATTTGGG + Intronic
1028773318 7:94652262-94652284 AAGTGTTAGAATATGCATTTAGG + Intronic
1032632142 7:133664942-133664964 TTTTGTAAGTACATGCATTTTGG + Intronic
1032697177 7:134347573-134347595 ATGTATAAGAATATGCATTCTGG - Intergenic
1032899219 7:136287907-136287929 GTGTGTAAACACTTGCATTTTGG + Intergenic
1033685062 7:143631833-143631855 ATATGTAAGCATAAACATTTTGG - Intronic
1033688235 7:143711052-143711074 ATATGTAAGCATAAACATTTTGG - Intronic
1033699551 7:143825788-143825810 ATATGTAAGCATAAACATTTTGG + Intergenic
1035397848 7:158546802-158546824 CTGTGTGTGCATCTGCATGTTGG - Intronic
1038098711 8:24346858-24346880 CTGTTTAAGGATGTGTATTTAGG - Intronic
1040062997 8:43120546-43120568 CTGTATAAATATATACATTTTGG + Intronic
1042074613 8:64978221-64978243 CTGTGTGTGAAAATGCATTTTGG + Intergenic
1042413980 8:68498193-68498215 ATGTGTGTGCATATGCATGTGGG - Intronic
1043245743 8:77998497-77998519 CTGTGTAGGCAAACACATTTGGG - Intergenic
1044541418 8:93412380-93412402 CTGTGTAATCAGATAGATTTGGG + Intergenic
1048702379 8:137107093-137107115 CTGAGATAGAATATGCATTTGGG - Intergenic
1050687636 9:8190064-8190086 CTGTGTAAGCATTTTAGTTTTGG + Intergenic
1056948989 9:91026824-91026846 CTGTGCAAGCTTATGCATCAAGG - Intergenic
1059821329 9:117976116-117976138 ATGTATAAGGATATGTATTTTGG - Intergenic
1060570857 9:124638572-124638594 CTTTGTAAAAATATGCATTCAGG + Intronic
1062528791 9:136990571-136990593 CTGGTTAAGCAGCTGCATTTGGG - Intergenic
1186376175 X:9004264-9004286 AGGTTAAAGCATATGCATTTTGG + Intergenic
1187477422 X:19624432-19624454 TTGTGTAGGCATATGCACCTGGG + Intronic
1188748037 X:33871553-33871575 AGGTTTCAGCATATGCATTTTGG + Intergenic
1194124201 X:89993116-89993138 CTGTGGAACCAGATGCATTAAGG + Intergenic
1194265567 X:91749511-91749533 GTGTGTTTGCATATGCATGTTGG - Intergenic
1195498578 X:105566979-105567001 CTGGCTGAGCAGATGCATTTAGG + Intronic
1195878002 X:109562453-109562475 CTGTGGAAGAAAATGCATTGTGG - Intergenic
1198795486 X:140390025-140390047 CTGAGAAAACAAATGCATTTGGG - Intergenic
1199370201 X:147038538-147038560 CTGTGTAAGCAAAGATATTTGGG - Intergenic
1199988823 X:152972374-152972396 CTTTGCAAGCCTATGCCTTTGGG - Exonic
1200477092 Y:3650738-3650760 CTGTGGAACCAGATGCATTAAGG + Intergenic
1200582718 Y:4969959-4969981 GTGTGTTTGCATATGCATGTTGG - Intergenic
1201614647 Y:15883734-15883756 GTGTGTGAGTATATTCATTTTGG - Intergenic