ID: 1001210781

View in Genome Browser
Species Human (GRCh38)
Location 5:169808312-169808334
Sequence GTGTGTTTGGGGAATGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 1, 2: 3, 3: 49, 4: 476}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001210774_1001210781 1 Left 1001210774 5:169808288-169808310 CCAAGCTTCCATTTGGGGGGCGC 0: 1
1: 0
2: 2
3: 3
4: 46
Right 1001210781 5:169808312-169808334 GTGTGTTTGGGGAATGGGACAGG 0: 1
1: 1
2: 3
3: 49
4: 476
1001210775_1001210781 -7 Left 1001210775 5:169808296-169808318 CCATTTGGGGGGCGCTGTGTGTT 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1001210781 5:169808312-169808334 GTGTGTTTGGGGAATGGGACAGG 0: 1
1: 1
2: 3
3: 49
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001210781 Original CRISPR GTGTGTTTGGGGAATGGGAC AGG Intronic
901029873 1:6300817-6300839 CTGTGTTTGTGGAGAGGGACCGG - Intronic
901031611 1:6310382-6310404 GGGTGGCTGGGGAATGGGCCTGG - Intronic
902239262 1:15077456-15077478 GAGTGTTTGGGGAGTGGCAGTGG + Intronic
902557509 1:17255626-17255648 GTGTGTTAGGAGAATGAGAGGGG - Intronic
902689049 1:18098290-18098312 GTGTGTGGGGTGCATGGGACAGG + Intergenic
902724154 1:18324022-18324044 GTGGGATGGGGGAGTGGGACCGG - Intronic
902973512 1:20072148-20072170 GTGTGTTTGGGGATGGGGACGGG - Intronic
904154053 1:28467407-28467429 GTGTGTGTGTGTAATTGGACTGG + Intronic
905290829 1:36920737-36920759 GTGGGTGTGGGGAATGGCACTGG - Intronic
905512731 1:38535562-38535584 GTCTGTTTGATGAATGGGTCAGG - Intergenic
905831968 1:41076745-41076767 GTGTGTTTGAGAAATTGGAAAGG + Intronic
905925447 1:41746348-41746370 GTTTGCTGGGGAAATGGGACTGG + Intronic
906098848 1:43243128-43243150 GAGTGTATGGGGAATGGGCAGGG - Intronic
906675916 1:47693558-47693580 GTGAGGTTGGGGAGTGGGGCTGG + Intergenic
906688807 1:47779340-47779362 GTGTGTGTGGGGAGAGGGGCTGG + Intronic
907032201 1:51183550-51183572 GTGTATTTGGGGAAGGGGAAGGG + Intergenic
907049177 1:51318173-51318195 CTGTGCTTGGGGTGTGGGACCGG + Intronic
907853713 1:58281041-58281063 GTGTGTTTGGGGAGAAAGACAGG + Intronic
908013659 1:59809593-59809615 GAATGTTTAGGTAATGGGACTGG - Intergenic
909335682 1:74470583-74470605 TTGTGTTTGGGGAATGAGAGAGG + Exonic
910366837 1:86474970-86474992 GTGTGTTTGGGGATGGGGCTTGG - Intronic
910896120 1:92071249-92071271 GTGTGTATGGGGTAGGGGGCAGG - Intergenic
910933112 1:92462215-92462237 GTGAGGCTGGGGAATGGGCCAGG + Intergenic
910989117 1:93036780-93036802 TTTTGTTTAGGGAATGTGACTGG + Intergenic
912442894 1:109712482-109712504 GTGTGTTTGGGGGTGGGGGCGGG + Intronic
913450761 1:118991030-118991052 GTGTGTCTGTGGAATGGGGGTGG - Intergenic
913686741 1:121239375-121239397 GAGTGTTTGGGCATTGGGATGGG + Intronic
914038595 1:144026961-144026983 GAGTGTTTGGGCATTGGGATGGG + Intergenic
914150860 1:145040968-145040990 GAGTGTTTGGGCATTGGGATGGG - Intronic
915204686 1:154261251-154261273 GGGTGGTGGGGGAATGGGGCTGG + Intronic
915913211 1:159927146-159927168 GTGAGTCTGGGGATTGGAACAGG - Exonic
916247545 1:162704257-162704279 TGGTGATTGGGGAATGGAACAGG - Intronic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
916931413 1:169581622-169581644 ATCTGATTGGGGAAAGGGACAGG + Intronic
917684115 1:177398549-177398571 GTGTGTCTGTGGGAGGGGACAGG - Intergenic
917688610 1:177444456-177444478 GCAGGTTTGGGGAATGGGATTGG + Intergenic
919854775 1:201697766-201697788 GTGTGGTTTGGGGATGGGAATGG - Intronic
920474066 1:206257842-206257864 GAGTGTTTGGGCATTGGGATGGG + Intronic
920930928 1:210387217-210387239 GTGCATTTGGGGAATGGCAATGG + Intronic
921254542 1:213327609-213327631 GTGTGTTTTGGGGATGGGGTTGG + Intergenic
921697901 1:218233244-218233266 ATGTGTTTGAGTAATTGGACTGG - Intergenic
921752452 1:218811668-218811690 GTGTGTTTTGGGAATGGCAAGGG + Intergenic
922000352 1:221471276-221471298 GTGTGTTTGGAGGATGGGGAGGG - Intergenic
922875533 1:228937170-228937192 GGGTGGTTGGGGACTGGCACAGG - Intergenic
923035478 1:230282174-230282196 GTGGGTGTGGGGACTGGGATTGG + Intergenic
923871268 1:237996497-237996519 GTGTGTTTGGGGAATGGGAGGGG + Intergenic
1062795497 10:341991-342013 TTGTGTCTGGGGAATGTGAGTGG + Intronic
1066319420 10:34286572-34286594 GTGTCTTTGAGGAATGGCAAGGG + Intronic
1067581357 10:47448274-47448296 GTGTGTTGGGGGTATGTGATAGG + Intergenic
1067833086 10:49621506-49621528 GAGTGCTTGGGGAAAGGCACTGG - Intronic
1069238026 10:66102731-66102753 GTGTGTTTGGGGGCAGGCACAGG + Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1071121788 10:82287169-82287191 GGGTGTTTGGGTCATGGGGCAGG + Intronic
1071344518 10:84680014-84680036 TTGGGGGTGGGGAATGGGACTGG + Intergenic
1072767665 10:98108759-98108781 GAGTCTTTGGGGAGTGGGAACGG + Intergenic
1074767973 10:116714544-116714566 GTGTGTCTGGGGGAGGGGGCAGG - Intronic
1075065905 10:119288696-119288718 GTGTGTGTGGGGAGTGGGGGTGG + Intronic
1075173430 10:120137166-120137188 GTGTGGTTGGTGAATGGTAAGGG - Intergenic
1075742225 10:124702813-124702835 GGGTGTTTGGGTCATGGGAGCGG + Intronic
1075945410 10:126428697-126428719 TTGGGTTTGGGGACTGGGAGGGG + Intronic
1076364604 10:129914025-129914047 GTGGGTTTTGTGAATGGGATGGG - Intronic
1076901139 10:133338402-133338424 GTGTGTCTGGGGTGTGGGTCAGG - Intronic
1078339419 11:10488389-10488411 GTGTGGTAGGGGAATGGAAGTGG + Intronic
1078633341 11:13026628-13026650 TTATCTTTGGGAAATGGGACTGG + Intergenic
1079162113 11:18004932-18004954 GTGAGTTTAGGAGATGGGACAGG + Intronic
1079388647 11:20002237-20002259 GTGAATTTGGGGCATGGGAAGGG + Intronic
1080963376 11:37186232-37186254 CTGTGGTTAGGGAATGGGACCGG - Intergenic
1081078607 11:38709862-38709884 GTGTGTTTGAGGAACATGACAGG + Intergenic
1081977681 11:47246055-47246077 GAGTGTTTGGGGGATGGGGAAGG - Intronic
1083050198 11:59770038-59770060 GTGTGTATGTGGAATGGGTGTGG + Intronic
1085030189 11:73266392-73266414 GTGTGTTTGGGAACTGGCAGGGG + Intronic
1085500662 11:77019803-77019825 GTGTGTTGGGGGTATGGTACTGG + Intronic
1085745163 11:79108919-79108941 GTTTGTGTGGGGAATGGGGAAGG - Intronic
1086394764 11:86403422-86403444 TGGTGTTTGGGGACTTGGACAGG - Intronic
1089118513 11:116114962-116114984 GTGTGTTGGGGGATGGGGAGGGG - Intergenic
1089478903 11:118790247-118790269 GTGTGTTTGGGGCGTGGGGCGGG - Intronic
1089743344 11:120600124-120600146 GTGTGTTTGGGGAAAGGGAAAGG + Intronic
1089939900 11:122405260-122405282 GGGTGTTTGGGACATGGGAGTGG - Intergenic
1090238785 11:125167184-125167206 GTGTGTGTGGGGGGTGGGAGCGG + Intronic
1090408350 11:126490996-126491018 GTCTCTTTGGAGAATGGGGCAGG + Intronic
1090929450 11:131282289-131282311 GTGTGTTTGGGTCATGGGGGAGG - Intergenic
1091923710 12:4326349-4326371 GTACGTTTGGGGAATGGGAAAGG - Intronic
1093895171 12:24566628-24566650 GAGTGGTTAGGGAATGGGTCTGG - Intergenic
1095591861 12:43912346-43912368 GTGGGGTGGGGGAAGGGGACAGG + Intronic
1095686051 12:45035119-45035141 ATGTGTTTTGGGAATGGTTCAGG - Intronic
1096188795 12:49601122-49601144 GTGCGTTTGGACACTGGGACAGG + Exonic
1096283329 12:50275950-50275972 GTGTGTCTGAGGGATGGGCCTGG - Intronic
1096354237 12:50926798-50926820 TTGCCTTTGGGGAATGGGATTGG + Intronic
1096693353 12:53334451-53334473 GTGTGTTTGTGAGATGGGGCAGG - Intronic
1097053843 12:56238736-56238758 GTGTGTTTGGGGGGTGGGGGTGG - Exonic
1098357643 12:69626644-69626666 GTGTCCTTGGGAAATAGGACAGG + Intergenic
1098934012 12:76456364-76456386 GTGTATTTAGGGACTGGGAGTGG + Intronic
1099790191 12:87324233-87324255 GTGTGGTGGGGGAGTGGGGCAGG - Intergenic
1100618125 12:96247461-96247483 GTGAGTTGGGGGACAGGGACGGG - Exonic
1100678920 12:96897939-96897961 GTGTGTGTGGTGAGTGTGACTGG + Intergenic
1102708091 12:114900019-114900041 GTGTTCTTGGGGAACGAGACAGG - Intergenic
1103362973 12:120364585-120364607 GAGTGTTTGTGGAATGGGCTGGG - Intronic
1103941977 12:124506166-124506188 TTGTGTTTGGTGAATGGAACTGG - Intronic
1104821292 12:131679030-131679052 GTGTGATCGGGGATTGGGTCTGG - Intergenic
1105404162 13:20119556-20119578 GTGTGTTTGGGGGTCGGGGCAGG - Intergenic
1106142025 13:27019596-27019618 CAGAATTTGGGGAATGGGACAGG - Intergenic
1106240506 13:27908616-27908638 GTGTTTTGGGGGAGTGGGACGGG + Intergenic
1107329048 13:39277846-39277868 TGGTGTTTGGGAAAAGGGACAGG - Intergenic
1109589000 13:64451452-64451474 GTGTGTTTGGGGCAGGGGGGTGG - Intergenic
1109591101 13:64483753-64483775 GTGTGTTTGTGTAATGGGAGAGG + Intergenic
1110310041 13:74038221-74038243 CTGTGTCTGAGGAATGGGAGGGG + Intronic
1110710756 13:78648263-78648285 GTGTGTTTGGGGGAAGTTACAGG - Intronic
1111891833 13:94092112-94092134 GTGTGTTTGCGGGGTGGGGCGGG + Intronic
1112393772 13:99009666-99009688 GTGGGTTTGGGGGTGGGGACAGG - Intronic
1113229925 13:108202235-108202257 GTTGGTTTGGGAGATGGGACTGG - Intergenic
1113465282 13:110508237-110508259 GTGTGGTTGGGGAGGGGAACTGG - Intronic
1113955573 13:114098565-114098587 GTGTGTGTGTGGAATGGGGCTGG + Intronic
1114781173 14:25539630-25539652 GTGTGAGTGGGAAATGGGTCAGG - Intergenic
1114840106 14:26253163-26253185 GTGTGTTTGAGAAAGGGGAGGGG - Intergenic
1116687487 14:48058875-48058897 GTGTGTTTGGGGGAGGGGTGAGG - Intergenic
1117933391 14:60872291-60872313 AGGTGTTTGGGTCATGGGACTGG - Intronic
1118967445 14:70600877-70600899 GTGGGGTAGGGGAATGGGAGGGG + Intergenic
1119142023 14:72275970-72275992 GAGACTTTGGGGACTGGGACTGG + Intronic
1119335222 14:73827814-73827836 GTGTATTGGGGGGATGGGAATGG - Intergenic
1119416904 14:74477025-74477047 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1119416916 14:74477104-74477126 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1121718974 14:96096150-96096172 TTGTGCTTGGGGCATGGGAGGGG - Intergenic
1122557628 14:102590235-102590257 GTCTGTTTGGGTACTGGGAGAGG + Intergenic
1122597796 14:102905176-102905198 GAGGGTTTGGTGAATGAGACAGG - Intronic
1122781252 14:104144499-104144521 GTGGGCTAAGGGAATGGGACTGG + Intronic
1122979813 14:105186422-105186444 GTGTGTGTGGGGTATGTGAGTGG + Intergenic
1122979853 14:105186558-105186580 GTGTGTGTGGGGTATGTGAGTGG + Intergenic
1122979893 14:105186694-105186716 GTGTGTGTGGGGTATGTGAGTGG + Intergenic
1123760154 15:23425508-23425530 GGGTGTTTGGAGAGTGGGGCAGG + Intergenic
1125702127 15:41695942-41695964 GTGTTTTTGAGGAATGGCTCAGG + Intronic
1125722136 15:41850310-41850332 GTGTGTTCAGGGAATGTGTCTGG - Intronic
1126419493 15:48456409-48456431 GTGTGTTGGGGGAAAGGGGCTGG + Intronic
1126986975 15:54322881-54322903 GTATGTTTGGGGACATGGACAGG + Intronic
1128187409 15:65654500-65654522 GTGTGTTTGGGGCAGAGGTCAGG - Exonic
1128234310 15:66057154-66057176 GGGAGTTGGGGGAATGGGAAGGG - Intronic
1128385664 15:67146550-67146572 GTGTGTTCGGGGATGGGGAGCGG + Intronic
1128579351 15:68797940-68797962 GTGTGGGTGGGGAATGGCTCTGG + Intronic
1128671332 15:69576621-69576643 GTTTTTTTGGGGAAAGGGAAAGG + Intergenic
1128864743 15:71105979-71106001 GAGGGTTTGGGGGGTGGGACAGG + Intronic
1129914237 15:79254281-79254303 GGGTTATTGGGGAATAGGACAGG + Intergenic
1129942455 15:79510184-79510206 GTGTGTTTAGGGAACTGGATAGG - Intergenic
1131195701 15:90352824-90352846 CTGTGCATGGGGAAAGGGACGGG + Intronic
1131424150 15:92331866-92331888 GTGTATTGGGGGATTGGGTCTGG - Intergenic
1131856858 15:96606267-96606289 GGGAGTTTGGGGAAGGGGTCAGG + Intergenic
1133737856 16:8629471-8629493 GCGTGTTGGGGGTGTGGGACAGG + Intronic
1134456186 16:14397368-14397390 GGGTGTTTGGAGAGTGGGGCAGG - Intergenic
1134838908 16:17385235-17385257 GTGTGTTATGGGGATGGGGCAGG - Intronic
1135227217 16:20671424-20671446 GTGTGTCTTGGGAAAGGAACTGG - Intronic
1135915973 16:26605790-26605812 TTGTGTTTGGGGAATCAGCCTGG - Intergenic
1136412818 16:30086690-30086712 GTGTGTCTGGGGAGAGGGAAGGG + Exonic
1137002210 16:35239058-35239080 GTGTGTGTTGGGGATGGGACAGG - Intergenic
1137016127 16:35377276-35377298 GTGTGTTTTGGGGATAGGACAGG - Intergenic
1138584246 16:57960193-57960215 GTCTGTTTGAGGATTGGGATGGG - Intronic
1139470576 16:67176109-67176131 GTGTGTGTGTGTAATGGGAGTGG + Exonic
1139512698 16:67436411-67436433 GTGGGGGTGGGGAATGGGGCTGG + Intronic
1140058727 16:71548724-71548746 GAGTGTTTCGGGAAAGGGGCAGG - Intronic
1140865065 16:79052958-79052980 GTGTATTTGGGGGTTGGGATGGG + Intronic
1142205573 16:88781411-88781433 GCGTGTTTGGGGAAGGGGCCAGG - Intronic
1142418130 16:89954167-89954189 GTGTGGTTGGGGAAAGGGGGTGG + Intronic
1142687002 17:1583181-1583203 GTGGGTGTGGGGAGTGGGAGGGG - Intronic
1143237170 17:5412809-5412831 GTGGGGTAGGGGAGTGGGACAGG - Intronic
1143356819 17:6335755-6335777 GTAGGTCTGGGGAGTGGGACAGG - Intergenic
1143393905 17:6576793-6576815 GTGTGTTGGGGGAGTGGGGGAGG - Intergenic
1144621846 17:16823098-16823120 GTGTATTTCAGGGATGGGACAGG - Intergenic
1144884578 17:18449616-18449638 GTGTATTTCAGGGATGGGACAGG + Intergenic
1145147652 17:20494761-20494783 GTGTATTTCAGGGATGGGACAGG - Intergenic
1145957046 17:28861774-28861796 GTGGGTTATGGGAAGGGGACTGG + Intergenic
1146329652 17:31917084-31917106 GTGTGGTAGGGGACTGGGACAGG + Intergenic
1146489392 17:33269474-33269496 GTGTGTTTGGGGGATGGAGGAGG - Intronic
1146996797 17:37327894-37327916 GTGTGTTGGGGGGTTGTGACTGG - Intronic
1147732459 17:42612513-42612535 TTGTGTTTGGGGATTAGGAAAGG + Intronic
1148686213 17:49502577-49502599 GTGTGTTTGGGGGAAGGGAGAGG + Intronic
1148755515 17:49971106-49971128 ATGTGTTTGGGGACTGGGGTGGG + Intronic
1148757460 17:49981077-49981099 CTGGGCTTGGGGAATGTGACAGG - Intergenic
1149100243 17:52897392-52897414 GTGTGTTTGGACAAGGGGAAAGG - Intronic
1149370266 17:55987123-55987145 GAGTGTTTAGGGGATGGAACTGG - Intergenic
1150283924 17:63945069-63945091 GTGTGGTTGGGGAGTGAGCCGGG + Intronic
1150817096 17:68400935-68400957 GTGTGTTTGGGCACAGGGATAGG + Intronic
1152466338 17:80468654-80468676 GTGTGTTTGGGGAGGGGGAGAGG + Exonic
1152966611 18:121343-121365 GCAAGTTTGGGGAATGGGAGAGG + Intergenic
1153477024 18:5508408-5508430 ATGTGTTTGGAAAATAGGACAGG - Intronic
1154310661 18:13264033-13264055 GTCTGTTGGGGGCATGGGAGGGG + Intronic
1154927377 18:20950723-20950745 GCAAGTTTGGGGAATGGGAGAGG - Exonic
1155060886 18:22227406-22227428 GTGACTTTGGGTAATGGAACTGG + Intergenic
1155305312 18:24472656-24472678 GTGTGATAGGGGAAAGGGATGGG + Intronic
1155700157 18:28733465-28733487 GTGTGGGTGGGGAATGGCAAGGG + Intergenic
1156901183 18:42302105-42302127 GGGTGTGTGGGGAGTGAGACTGG - Intergenic
1157299274 18:46467914-46467936 GTGTGGTTGGGGAGGGGGAGAGG - Intergenic
1158409021 18:57187843-57187865 GTGTGTATGGGGAATTGGGGTGG + Intergenic
1159689169 18:71464441-71464463 ATCTGATTGGGGAATGGAACGGG + Intergenic
1159862491 18:73665470-73665492 GGGGGTTTGGGGACTGGGAGAGG - Intergenic
1160337013 18:78051181-78051203 GGGTGGTTGGGGAAGGAGACTGG + Intergenic
1160501347 18:79402411-79402433 GTGTTTTGGGGGAATGAGCCCGG - Intronic
1160626443 18:80210890-80210912 GTGTGTTTGGGGATGGGGGGTGG - Intronic
1160929043 19:1561091-1561113 GTGGGTTGGGGGTGTGGGACAGG - Intronic
1161196581 19:2989786-2989808 GTGCGTTTGGGGGGTGGGAAGGG + Intronic
1161202897 19:3025668-3025690 GTGTGGGTGGGGAAGGGGGCGGG + Intronic
1161434032 19:4251194-4251216 GTGTGCTGGGGGAGAGGGACCGG - Intronic
1161447478 19:4326769-4326791 GTGTGTGTGGGGGAGGGGGCGGG - Intronic
1161985851 19:7653390-7653412 GTGGGTTTGGGGAATGTCCCTGG + Intergenic
1162065639 19:8123761-8123783 GTGCGGTTGGGGAAGGGGTCAGG - Intronic
1162466973 19:10848304-10848326 GTGTGTTTGGGGAAGGGGTGGGG + Intronic
1163709064 19:18834630-18834652 TTGTTTGTGGGGAATGGGAGTGG + Intronic
1164394295 19:27850366-27850388 GTGTGTGTGGGGAAGGGGTGTGG + Intergenic
1165799421 19:38538463-38538485 TTGCTTTTGGGGAATTGGACTGG - Intronic
1167740063 19:51319143-51319165 GTGTGTCTGGGGGATAGGGCAGG + Intronic
1168505764 19:56933463-56933485 GTCTGTTTGGAGGATGGGATGGG - Intergenic
926023907 2:9522338-9522360 ATGTCTTTGGGGAAAGGAACTGG + Intronic
926025150 2:9536124-9536146 GTTTGTTTTGGGAAAGGGATAGG - Intronic
926497529 2:13609333-13609355 GTGGCTCTGGGGAATGGGAGGGG + Intergenic
926591897 2:14749404-14749426 GTTTGTTTGGAGAATGGTGCAGG - Intergenic
927066493 2:19476614-19476636 GTGTGTTTGGTCAATGGAATTGG - Intergenic
927238854 2:20902322-20902344 GTGTATTTGGGGGATGGTAGAGG - Intergenic
927712811 2:25336237-25336259 GTGTGTTGGGGGACAGGGTCAGG + Intronic
927838777 2:26423331-26423353 GGGTGGGTGGGGGATGGGACAGG + Intronic
928963682 2:36955711-36955733 GTGTGTTGGAGGTAGGGGACAGG - Intronic
929693202 2:44091657-44091679 GTGTGTTTGGGGAAAGTATCTGG + Intergenic
929766131 2:44845342-44845364 GTGTGTTTGGGGGCTGGGTGGGG + Intergenic
929899554 2:45989011-45989033 ATGAGTGTGGGGGATGGGACGGG - Intronic
929928570 2:46234687-46234709 GTGTGGTTGGGAAAAGGCACTGG + Intergenic
929949247 2:46393711-46393733 CTGTGCTCGGGGCATGGGACTGG + Intergenic
930041399 2:47128177-47128199 GTTTGTTTGGGGGAAGGGAAGGG - Intronic
931232182 2:60384208-60384230 GTGTGTTTTGGGGGGGGGACAGG - Intergenic
932805318 2:74778182-74778204 GTGGGTGTGGGGAGTGGGGCAGG + Intergenic
933286678 2:80391876-80391898 GTGAGTTTAGGGAGTGGGAAAGG + Intronic
933311681 2:80668610-80668632 GAGTGTTTGGGACTTGGGACTGG + Intergenic
933694862 2:85210235-85210257 ATGTGTGTGGGGAAGGGGCCAGG - Intronic
933796252 2:85922215-85922237 TTGTGTTTGGGGAATTTGAACGG - Intergenic
933943982 2:87268373-87268395 CTGAGTCTGGAGAATGGGACTGG + Intergenic
934605199 2:95689831-95689853 GTGTGTTTGGCTCCTGGGACTGG + Intergenic
934646151 2:96060401-96060423 GTGTGTTTGGGAGAAGGGAGGGG - Intergenic
934839554 2:97616484-97616506 GTGTGTTTGGGAGAAGGGAGGGG - Intergenic
934985838 2:98884036-98884058 GTGTGTTGGGGGGATGGGGCAGG + Intronic
935200896 2:100855751-100855773 GTGAGTTTGGGGAATGGGCCTGG - Intronic
935539794 2:104336035-104336057 GGGTGTATGGAGAATGGAACAGG - Intergenic
936336238 2:111593206-111593228 CTGAGTCTGGAGAATGGGACTGG - Intergenic
938591310 2:132738909-132738931 GGGTGTTTGGGTCATGGGAGTGG - Intronic
940395747 2:153189210-153189232 TGGGTTTTGGGGAATGGGACGGG - Intergenic
941018113 2:160379906-160379928 GTGTGTTTGGGGGCTGGGTGTGG + Intronic
941257903 2:163256849-163256871 GTGTGTTCAGGGGATGGGAATGG - Intergenic
942199130 2:173553339-173553361 GTGTGTTTTTGGAAAGGAACAGG - Intergenic
944836089 2:203581328-203581350 GTGGGTTGGGGGGATGGGGCGGG - Intergenic
945500789 2:210571905-210571927 GTGTGTATGTGTAATGGGAGTGG + Intronic
945931438 2:215859438-215859460 GTGTGTTTGTGTAGTAGGACTGG - Intergenic
946177080 2:217928584-217928606 CTGGGTTTGGGGAAAGGGCCAGG - Intronic
946889897 2:224264443-224264465 GTGTGTTTGGGGAGAGGAGCTGG + Intergenic
947390792 2:229637139-229637161 GTGTGTTGAGGGGATGGGAGTGG - Intronic
948190193 2:236052308-236052330 GTGTGTTTGGGGGTGGGGGCAGG - Intronic
948652471 2:239457055-239457077 GTGTGTTCTGGGAATGGCAGGGG + Intergenic
1168845913 20:944620-944642 GTGGGGGTGGGAAATGGGACTGG + Intergenic
1169217462 20:3801862-3801884 GTGGATTTGAGGGATGGGACGGG + Intronic
1169999844 20:11603782-11603804 GTGGATTTGGGGAATGGAAGTGG - Intergenic
1170016009 20:11783093-11783115 GTGTGTTTGAGGAACAGCACAGG + Intergenic
1170428612 20:16258589-16258611 GTGTGTTTGGGGATGGGAAGGGG - Intergenic
1171275841 20:23855901-23855923 TTGTGTTTGGTGAGTGGGGCAGG + Intergenic
1171412421 20:24956354-24956376 GGGTGATTGGGGAATGGGAGGGG - Intronic
1172425670 20:34854469-34854491 GTGGGTGTGGGGAAAGGGTCAGG - Intronic
1173054113 20:39594817-39594839 GTGTGTTTGGGGAAAAAGAAAGG + Intergenic
1173160015 20:40645463-40645485 GTGTGTTTGGGGGATCCCACGGG - Intergenic
1173314292 20:41929818-41929840 GAGGGAGTGGGGAATGGGACAGG - Intergenic
1173500238 20:43548011-43548033 GTGTGCATGGGGAATGGGGGAGG - Intronic
1173699030 20:45050175-45050197 GGGTGTGTGGGGACTGGGAAAGG + Intronic
1174447128 20:50597807-50597829 GTGGGATTGGGGCTTGGGACCGG - Intronic
1174689854 20:52493120-52493142 GTGTGTTTGGGGACGGGTAGGGG + Intergenic
1175247945 20:57592636-57592658 GTGGGCTGGGGGGATGGGACCGG + Intergenic
1175885732 20:62289442-62289464 GTTTGTTTAGGGAGAGGGACGGG - Intronic
1175936792 20:62517813-62517835 CTGTGTTTGGGGCATGGGGGAGG - Intergenic
1177789961 21:25712415-25712437 ATATGTTTGGGGAATAGGGCAGG + Intronic
1178391104 21:32199034-32199056 GTGTGTTTCAGGAATTGGAATGG + Intergenic
1178696622 21:34798202-34798224 GTGTGTTGGGGGAACGGGGCGGG - Intronic
1178710918 21:34916030-34916052 GTGTGTGTGGGGAAGGGGAGAGG + Intronic
1179021080 21:37641693-37641715 GTGTGTTTGGGGGATGGGCAGGG + Intronic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1181690612 22:24557308-24557330 GTGTGTCAGGGGAGGGGGACTGG - Intronic
1182032653 22:27171594-27171616 GTTTGACTGGGGAATGGGAGAGG - Intergenic
1182369052 22:29798214-29798236 GTCTGTTTGGAGAATGGGTGAGG - Intronic
1182472610 22:30557619-30557641 GAGAGGTTGGGGAATGGGGCAGG + Intronic
1182901511 22:33902349-33902371 GACTTTTTGGGGAATGGGATGGG - Intronic
1183567793 22:38628673-38628695 GTGTGGCTGAGGCATGGGACGGG + Intronic
1183575196 22:38683615-38683637 GTGTGGGTGGGGATTGGGATCGG + Intronic
1184457190 22:44617485-44617507 GTGTGTGTGGTGAATGTGTCTGG - Intergenic
1184457200 22:44617622-44617644 GTGTGTGTGGTGAATGTGTCTGG - Intergenic
1184457212 22:44617779-44617801 GTGTGTTTGGTGAATGTGTCTGG - Intergenic
1184768402 22:46584568-46584590 GTGTGTCTGCGTAGTGGGACTGG + Intronic
950798227 3:15528596-15528618 GTGTGGTTGGGGACTGGGATTGG - Intergenic
951701268 3:25499023-25499045 GTGTGTCTGGGATATGTGACAGG + Intronic
952788434 3:37177829-37177851 GTGTTTCTGGGAAAAGGGACTGG + Intronic
953018859 3:39101143-39101165 GTGGGGTTGGGGGATGGGAAAGG + Intronic
953233247 3:41083347-41083369 GTGTTATGGGGGAAAGGGACTGG - Intergenic
953338134 3:42111317-42111339 GTTTGTTTTGGGAAAAGGACTGG - Intronic
954453584 3:50585090-50585112 GAGTGGGTGAGGAATGGGACTGG + Intergenic
954644867 3:52125020-52125042 GGGTGTTTGGGGGATGGGCTGGG - Intronic
955815701 3:62839960-62839982 GTGTGTTTAGGGGATGGGCAGGG + Intronic
956427937 3:69155803-69155825 GTGGGTGTGGGGAAGGGGTCAGG + Intergenic
956769651 3:72513973-72513995 ATGTGTTTGGGGCATGTGCCTGG + Intergenic
956873504 3:73440742-73440764 GAGTGTCTCGGGGATGGGACAGG + Intronic
957243812 3:77692901-77692923 GTGTGTGTTGGGAAGGGGAGTGG - Intergenic
957900574 3:86483167-86483189 GTTTGTTTGGGTCATGGGAACGG + Intergenic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
958573236 3:95913382-95913404 GTGTGTTTGGGGTAGTTGACAGG - Intergenic
958661207 3:97069916-97069938 GTGTGTTTAAGGAGTGGGACTGG + Intronic
960793441 3:121458234-121458256 GTGTGGTGGGGGAATGGGGGAGG + Intronic
961515401 3:127429674-127429696 TTGTGTTTGGGAAATGTGACTGG + Intergenic
962275897 3:134013232-134013254 GTGTATTTGGGGTATGTGTCTGG - Intronic
962599771 3:136982946-136982968 GTGTGTTTGCGGAACAGGAGAGG + Intronic
963030690 3:140972304-140972326 GTGGGGTTGGGGAATTGGATAGG + Intronic
963642924 3:147880667-147880689 GAGGGTTTGGGGGATGGGAAAGG + Intergenic
965008329 3:163054922-163054944 GAGGGTTTGGGGAAGGGGAAAGG + Intergenic
965878009 3:173351837-173351859 GTGTGTTTGGGTCATTTGACAGG - Intergenic
965899837 3:173625333-173625355 GTGTGCTGGGGGGAGGGGACAGG - Intronic
966923941 3:184632347-184632369 GTGTGTGTGGGGGCTGGGAGCGG - Intronic
967678976 3:192337389-192337411 GTGTGTATGCAGAAAGGGACTGG + Intronic
968544775 4:1193308-1193330 GGGTGTGTGGGGCAGGGGACAGG - Intronic
968684886 4:1951296-1951318 GTGAGATTGGGGAAGGGGTCTGG - Intronic
969211063 4:5687574-5687596 GTGACTTTGGGGCAAGGGACTGG + Intronic
969542656 4:7803440-7803462 GTGGTTTTGGGGATCGGGACTGG - Intronic
970378800 4:15484545-15484567 GAGTTATTGGGGAATGGGACTGG + Intronic
970612489 4:17738751-17738773 GGGTGTTTGGGTCATGGGAGTGG + Intronic
970669669 4:18381497-18381519 GTAATTTTGGGGAATGGGGCTGG + Intergenic
970935940 4:21569945-21569967 GTGTGTTGGGAGAATGGGGGTGG + Intronic
971713002 4:30141323-30141345 GTGTGTGTGGGGCAGGGGGCAGG + Intergenic
972023363 4:34343293-34343315 ATGTGTTTGGGAAAAGGGTCTGG - Intergenic
972186095 4:36529912-36529934 GTGTGTTGGGAGAATAGGTCTGG + Intergenic
972360675 4:38322987-38323009 TTTTTTTCGGGGAATGGGACGGG - Intergenic
972488222 4:39562369-39562391 GTTTGTTTGGGGGTTGAGACAGG - Intronic
972503552 4:39698752-39698774 GTGGGTTGGGGGAAGGGGAAAGG + Intronic
972675146 4:41253032-41253054 GTGTGTTTGGGGGATGGGGAGGG - Intergenic
973552990 4:52053637-52053659 CTGTGGTTGGGGCATGGGAGAGG - Intronic
974413747 4:61577206-61577228 GTGTGTTAGGGAAATGGGGGGGG + Intronic
976051731 4:81017874-81017896 GTGTGTTTGGGGGCTGGGGCGGG + Intergenic
976877475 4:89872206-89872228 GTGTGTTTGGGGTAAGTTACTGG - Intergenic
978095277 4:104768760-104768782 GTGTGTTTGGTGAATGATCCAGG - Intergenic
978706812 4:111723137-111723159 GTGTGTTTTGGGGATGGGATAGG - Intergenic
978756031 4:112303891-112303913 GTGGGGTTGGGGAATGGGGGAGG - Intronic
980973384 4:139587776-139587798 GTGTTTGTGGGGAGGGGGACAGG + Intronic
981419695 4:144534953-144534975 GTGTACTGGGGGAATGGGAAAGG + Intergenic
981483071 4:145257573-145257595 GTGGGGTGGGGGAATGGGAGAGG - Intergenic
981577269 4:146218273-146218295 GTGAGTTTGGGGAGTGGGGGCGG - Intergenic
983153934 4:164320792-164320814 GTGTGTGGGGGGAGTGGGGCTGG + Intronic
983478639 4:168245935-168245957 ATGTCTTTGGGGAGTGGAACAGG + Intronic
983774526 4:171590773-171590795 GTGTTGTGGGGGAATTGGACAGG - Intergenic
984975671 4:185228099-185228121 GTGTGGTTTGGGGGTGGGACTGG + Intronic
985070134 4:186159439-186159461 GCCTGTTTGGGGACTGTGACTGG + Intronic
985322632 4:188731825-188731847 GCTTGTTTGGGGAATCGCACAGG - Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985852603 5:2399656-2399678 CTGTGTTTGTGGAGTGGGAGGGG - Intergenic
986586894 5:9328107-9328129 GTGAGTTTTGGGAGTGTGACTGG - Intronic
986864716 5:11972949-11972971 ATGTGTTTGGCCAATGGCACTGG + Intergenic
987067617 5:14304745-14304767 GTGTGTGTGGGGAGTGGGGTGGG + Intronic
988011882 5:25499125-25499147 GTGTGTATGAAGAATGAGACTGG + Intergenic
990323835 5:54655195-54655217 GTGTGTTTGTGGACTGAGTCGGG + Intergenic
990667268 5:58087284-58087306 GTGTGTTGATGGAATGGGGCTGG + Intergenic
991339084 5:65585656-65585678 GAGTATTTGGGGAAAGGGAGAGG + Intronic
992056795 5:72998141-72998163 GAATGTAAGGGGAATGGGACAGG + Intronic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
993231306 5:85240356-85240378 GTGTGGTGGGGGAATGGGGGAGG + Intergenic
995524324 5:113038589-113038611 GAATGTTTGGGGAATGGCATTGG + Intronic
996680878 5:126227304-126227326 GTTTTTTGGGGGAATGGGATTGG - Intergenic
997860187 5:137409002-137409024 GTGTGTTTGGGGAAGGGGTTTGG - Intronic
998176040 5:139902699-139902721 GTATGTAGGGGGAATGGGAGTGG + Intronic
998667069 5:144309518-144309540 GTGAGATTGGGAAATGGGCCAGG + Intronic
998990273 5:147807717-147807739 GAGTGCTTGGGGAAAGAGACTGG + Intergenic
999038911 5:148385015-148385037 TTGTGCTGGGGGAATGGGAAAGG - Intronic
999123849 5:149231414-149231436 GTGTGTTGGGGGATGGGGAATGG + Intronic
999265213 5:150262524-150262546 GTGAGGATGGGGAATGGGAGTGG - Intronic
999320851 5:150614276-150614298 GTGTGGTGGGGGAAGGGCACTGG - Intronic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
999532914 5:152482004-152482026 GTGTGTGTGGGGCAGGGGAAGGG - Intergenic
1000883909 5:166728752-166728774 GTGTGTTGGGGGAATGCTACTGG + Intergenic
1001119909 5:168971518-168971540 GTCTGTTTCGGGATTGGGAGTGG - Intronic
1001210781 5:169808312-169808334 GTGTGTTTGGGGAATGGGACAGG + Intronic
1001318070 5:170658388-170658410 GATTATTTGGGGAGTGGGACTGG - Intronic
1001584732 5:172826178-172826200 GTGGGAGTGGGGAATGGGTCTGG - Intergenic
1002528931 5:179832221-179832243 GAGAGTTTGGGGAGTGGGATGGG + Intronic
1002866701 6:1128140-1128162 GTGTGGTTTGGGGATGGGGCTGG + Intergenic
1003584609 6:7376097-7376119 GTGAGTTTGGGGGCTGGGAGTGG + Intronic
1003864688 6:10352058-10352080 GTGTGTATGGGAAAGGGAACAGG + Intergenic
1004235156 6:13868545-13868567 GTGAGTGTGAGGAATGGGACGGG + Intergenic
1004329134 6:14705554-14705576 GAGTGTTTGGGTAATGGGTTTGG + Intergenic
1005493589 6:26369468-26369490 TTGTGTTAGGGGATTGGGGCCGG + Intronic
1005899355 6:30204578-30204600 TTGTGTATGGGGAAGGGGAGCGG - Intronic
1005986242 6:30877423-30877445 GTGTGTATGGGGGATGGGGATGG + Intronic
1006030179 6:31172117-31172139 CTGTGTGAGGGGATTGGGACTGG - Intronic
1006276074 6:33006620-33006642 GTGTGTGTGTTGAATGGGAAGGG + Exonic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006428479 6:33980671-33980693 GTGGGGTGGGGGTATGGGACCGG - Intergenic
1006636301 6:35463632-35463654 TTGTGGTTGGGAATTGGGACGGG + Intronic
1008255952 6:49299749-49299771 GTGTATTTGGGGAATTGTAATGG - Intergenic
1008490212 6:52078523-52078545 CTTTGTTTTGGGACTGGGACTGG - Intronic
1008682087 6:53883446-53883468 GTGTATTTGGAGAGTGGGAGTGG + Intronic
1008714078 6:54267007-54267029 TTGAGTTTGGGTGATGGGACTGG - Intergenic
1010779869 6:79933240-79933262 GTTTGTTTTGGGACTGGGTCTGG + Intronic
1011698039 6:89930740-89930762 GTGTGATTCGGGAAGGGGACAGG + Exonic
1012541118 6:100363046-100363068 GTGTGTGTGGGGAGAGGGGCAGG - Intergenic
1012773125 6:103466378-103466400 GTGTGTTTGGGGAAGCAGAGGGG + Intergenic
1012970902 6:105729276-105729298 GTGTGCCTGGGGATTGGGGCTGG + Intergenic
1014813152 6:125907393-125907415 CTGTGTTTGGGGAGTGTGAAGGG - Intronic
1015443371 6:133273198-133273220 TTCAGTTTGGGGAATCGGACTGG - Intronic
1016974517 6:149794288-149794310 GTGTGTCTGGGGAATACAACTGG - Intronic
1017866690 6:158450142-158450164 CTCGTTTTGGGGAATGGGACTGG + Intronic
1018715513 6:166529798-166529820 GTGTGTTTGGGGGCGGGGAGAGG - Intronic
1018953048 6:168391485-168391507 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953081 6:168391621-168391643 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953146 6:168391864-168391886 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953162 6:168391918-168391940 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953217 6:168392134-168392156 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953246 6:168392241-168392263 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953267 6:168392324-168392346 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953284 6:168392379-168392401 GTGTGCTGGGGGTAAGGGACAGG - Intergenic
1018953302 6:168392433-168392455 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953312 6:168392460-168392482 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953322 6:168392487-168392509 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1019351631 7:556762-556784 GTGTGTTTGGAGAAGGTGAAAGG - Intronic
1019360665 7:602697-602719 GTGTGTTGGGGACATGAGACGGG + Intronic
1019849368 7:3538958-3538980 GCCAGTTTGGGGGATGGGACAGG - Intronic
1019857173 7:3620820-3620842 GTGTGGGTGGGTAATGGGAATGG - Intronic
1020244549 7:6420607-6420629 TTGTGTTAGGGGTGTGGGACTGG + Intronic
1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG + Intergenic
1020500841 7:8918246-8918268 AAGTGTTTTGGGAATGGGAAAGG - Intergenic
1021545966 7:21813041-21813063 ATGAGTTTGAGGGATGGGACAGG + Intronic
1023109746 7:36797248-36797270 GTGTGCTTGGTGAAGGGGGCAGG - Intergenic
1023299194 7:38750784-38750806 TTGTGCTTAGGGAATGGGAAGGG + Intronic
1024039826 7:45543651-45543673 GTGTGTGTGTGGATTGGGTCAGG + Intergenic
1024374557 7:48622217-48622239 GTGTGTTTTGGTAATGCCACAGG - Intronic
1026047841 7:66919999-66920021 AAGTGTTAGGGGAATGGGATGGG - Intergenic
1027172106 7:75879603-75879625 GTGTGTATGTGAAATGGGAGGGG - Intronic
1027744598 7:82057441-82057463 ATGTGTTGGGGGAAAGGGGCAGG + Intronic
1028614355 7:92748817-92748839 GTGTGGATGGGGAATGGGAGTGG - Intronic
1029475974 7:100784839-100784861 GTGGGCATGGGAAATGGGACTGG + Intronic
1029729386 7:102429513-102429535 TTGAGTTTGTGGAAGGGGACAGG + Intergenic
1030438245 7:109552428-109552450 GAGTGCCTGGGGAATGGGGCAGG + Intergenic
1030759679 7:113334914-113334936 GTGGGGTTGGGGGATGGGAGAGG + Intergenic
1031143311 7:117969549-117969571 GTGGGGTTGGGGAAGGGGGCAGG + Intergenic
1032293505 7:130612940-130612962 GTAAGTGTGGGGTATGGGACAGG - Intronic
1032827583 7:135587160-135587182 GTGTGTTTGGGAAATGAGTGGGG + Intronic
1032842767 7:135727183-135727205 TGGGGTTGGGGGAATGGGACTGG + Intronic
1032854919 7:135825971-135825993 GTGTGTTGGGGGAGGGGGAGAGG + Intergenic
1033050063 7:137996084-137996106 GAATATTTGGGGAATGGGAGAGG - Intronic
1033108258 7:138550657-138550679 GTCTGTTTAGGAAATGGAACTGG - Intronic
1033761056 7:144437184-144437206 GTTTATTTGGGGAAGGGGAGAGG + Intergenic
1033882588 7:145903283-145903305 GTGTGCTTGGGGAGGGGGATGGG + Intergenic
1034347886 7:150398144-150398166 GTGTGTGTGGGGAGTGGGGGTGG + Exonic
1034954792 7:155327705-155327727 GTGTGATTTGGGCATGGGACTGG - Intergenic
1035204684 7:157287502-157287524 GTCTGTCTGGGGAAAGGGTCAGG - Intergenic
1035233546 7:157481434-157481456 GTGTGTTTGTGGTATGTGAGTGG + Intergenic
1036289405 8:7474014-7474036 GTGTCTTTGGGAAATGACACGGG + Intronic
1036332074 8:7837518-7837540 GTGTCTTTGGGAAATGACACGGG - Intronic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037557111 8:20035469-20035491 GTGGGGTGGGGGAATGGGAGAGG - Intergenic
1038105591 8:24430330-24430352 GTGGGTTTGGGGAAAGTGATGGG + Intergenic
1038275607 8:26118356-26118378 GTGGGTTTGGCCAATGGGAGGGG - Intergenic
1038546046 8:28426525-28426547 CTGTGTTTGAGCAATGGGAAAGG - Intronic
1038695512 8:29803062-29803084 GTGTGTTTGGGGTGTGGGGGGGG + Intergenic
1039760430 8:40568785-40568807 ATGTGTATTGGGAATGAGACTGG - Intronic
1040299023 8:46178432-46178454 GTGGGCTTGGGGTATGGGAGAGG - Intergenic
1040304931 8:46207112-46207134 GTGGGCTTCGGGAATGGGAAAGG - Intergenic
1040709869 8:50175352-50175374 GGAGGTTTGGGGAATGGGAATGG - Intronic
1041538762 8:58958972-58958994 GAGTGGTTGGGGAATGGGGTTGG - Intronic
1042155437 8:65840972-65840994 GTGTGTATGGGAAGGGGGACAGG + Intronic
1043147873 8:76679034-76679056 GTGTGCATGGGGAAGGGGAGTGG - Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1044112886 8:88298244-88298266 GGGTGTTTGGGGAAGGGAAGTGG - Intronic
1044381774 8:91542170-91542192 GTGTGTTTGAGGAAGAGCACGGG + Intergenic
1045469918 8:102503112-102503134 GTGTGTTTGGGGCATGGGGGTGG + Intergenic
1045581304 8:103483286-103483308 GTGGGGATGGGGAATGGGAAGGG + Intergenic
1045641733 8:104259101-104259123 GTGTGGTTGGGGGATGGTTCCGG + Intergenic
1046530774 8:115442597-115442619 GTGTGTTTGGGGGAAGGAAGGGG + Intronic
1046831768 8:118754103-118754125 GTGTTTTTGGGGGATGGGGGAGG - Intergenic
1046890355 8:119415847-119415869 GTGTGTTGGGGGGAGGGGAGTGG - Intergenic
1047455113 8:125001101-125001123 ATGGGTTTGAGGAATGGGAAAGG + Intronic
1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG + Intergenic
1048494302 8:134922428-134922450 GTGTGTTTGGAGGATGAGAGTGG + Intergenic
1049310626 8:141931919-141931941 GTGAGGTTGGGGAGAGGGACAGG - Intergenic
1050741184 9:8822809-8822831 GTGGTTTTGGGGGATGGGAGGGG - Intronic
1051376242 9:16405420-16405442 GAGTGATTGGGGAATGGGGGTGG - Intergenic
1053229761 9:36397958-36397980 GTGTGTTTGGAGAGAGGGAGAGG - Intronic
1053313188 9:37032345-37032367 GTATGTGTGGGGAATGAGGCGGG - Intronic
1053379887 9:37640018-37640040 ATGAGTTTGGGGAATAGCACTGG + Intronic
1053683443 9:40499917-40499939 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1053719778 9:40933764-40933786 GTGGGTTGGGGGAAGGGGACAGG + Intergenic
1053866145 9:42438602-42438624 GTGGGGTTGGGGAATGGGGGAGG - Intergenic
1053933422 9:43128232-43128254 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054280272 9:63125011-63125033 GTGTGTGTGGGGGTGGGGACTGG + Intergenic
1054296546 9:63335415-63335437 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054394564 9:64639920-64639942 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054429213 9:65145119-65145141 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054501171 9:65876416-65876438 GTGTGTGTGGGGGTGGGGACTGG + Intergenic
1055202941 9:73689747-73689769 GTGTGTTTGGGGGAGGGGAAAGG + Intergenic
1056420928 9:86425481-86425503 GTGTGTATGCGGAATGGGGCAGG - Intergenic
1058654570 9:107208122-107208144 TGGTGTTTGGGGAATGGAAGAGG - Intergenic
1059104473 9:111499953-111499975 GGGTTTTTGGGGAGTGGGATAGG + Intergenic
1059486155 9:114628468-114628490 CTGTGTTTTGGGAATGTGAGAGG + Intronic
1059672149 9:116501899-116501921 CTGAGTTTGGGGAATGGGATGGG - Intronic
1059921528 9:119165917-119165939 CTGTGTGTGGGGAACGGGAGTGG + Intronic
1059982240 9:119785624-119785646 GTGTGTTTGGGAGAGGGCACTGG + Intergenic
1060033262 9:120233665-120233687 GTGTGTTTAGTGAATGGGTGGGG - Intergenic
1060434648 9:123583089-123583111 GTGACTTTGGGGAATGGGGAAGG - Intronic
1061610591 9:131742839-131742861 GTGTGTTTTGGGGTTGGGCCTGG - Intergenic
1061889142 9:133608634-133608656 GGGTGTTGGGTGAATGGGATGGG + Intergenic
1203455228 Un_GL000219v1:160822-160844 GTGGGTTGGGGGAAGGGGGCAGG - Intergenic
1203655958 Un_KI270752v1:25050-25072 GTGTGTTGGGGGGAGGGGTCGGG - Intergenic
1185631269 X:1517411-1517433 GGGTGTTTGTGGGATGGGGCGGG - Intronic
1186515421 X:10163275-10163297 GTGTGTATGGGGGAAGGGATAGG - Intronic
1186612313 X:11149457-11149479 GTGTGTTGGGGGAGGGGGGCAGG + Intronic
1187435429 X:19264158-19264180 GTGGGTGAGGGGAATGGGAGTGG - Intergenic
1187991788 X:24882000-24882022 GTGTGATTGGGAGATGGGAGTGG + Intronic
1188150821 X:26673071-26673093 GTGGGTTGGGGGAATGGGGGAGG - Intergenic
1188776337 X:34224182-34224204 CTGTGTTTGGGGAATAGGGGTGG - Intergenic
1189393868 X:40602734-40602756 TTGTGTGTGGGGGATGGGAATGG + Intronic
1189428349 X:40923482-40923504 GGGTGTTTGGGGCATGGGAGTGG + Intergenic
1189564133 X:42222256-42222278 GTGAGTAGGGGGAAGGGGACAGG - Intergenic
1189700698 X:43714780-43714802 GTGTGGTGGGGAAATGGGGCGGG + Intronic
1190426683 X:50339880-50339902 GTGTGTTTGGGTCATGGGGATGG - Intronic
1191210815 X:57883060-57883082 GTGTGTGTGCTGAATGTGACAGG - Intergenic
1193810285 X:86042905-86042927 ATGTGTTTGGGTCATGGGAGTGG - Intronic
1194409683 X:93542818-93542840 GTGTGTTTGGGGAACAGAAAAGG + Intergenic
1195116514 X:101704401-101704423 GTGTGTATGTGGAATGGGGATGG - Intergenic
1196333175 X:114496254-114496276 GTGTGTATGTGTAATGGGATTGG - Intergenic
1196909992 X:120475322-120475344 GTTACTTTGGGCAATGGGACTGG - Intergenic
1198224477 X:134632611-134632633 GTGTGTTGATGGGATGGGACAGG - Intronic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1198531365 X:137551683-137551705 GTGTGTTTGGGGCAGGGGGTGGG + Intergenic
1198780964 X:140235298-140235320 GTGGGGTTGGGGGATGGGGCAGG - Intergenic
1199878542 X:151954566-151954588 TTCTGTTTGGGGAATGGGGCAGG + Exonic
1199965731 X:152819103-152819125 GTGTGTTTGGGGGTGGGGGCTGG - Intergenic
1201058456 Y:10019054-10019076 GTGTGTTTGTGTCATGGGGCTGG - Intergenic
1201528332 Y:14961549-14961571 GTGTGTTTGGGGCATGGAGGTGG + Intergenic