ID: 1001212080

View in Genome Browser
Species Human (GRCh38)
Location 5:169819446-169819468
Sequence TTTAATTTTTTGTAGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4118
Summary {0: 1, 1: 1, 2: 37, 3: 403, 4: 3676}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001212080_1001212086 25 Left 1001212080 5:169819446-169819468 CCCTACACCTACAAAAAATTAAA 0: 1
1: 1
2: 37
3: 403
4: 3676
Right 1001212086 5:169819494-169819516 ACCTGTAGTCCCGGCTACTCAGG 0: 187
1: 29475
2: 149631
3: 248215
4: 217023
1001212080_1001212085 16 Left 1001212080 5:169819446-169819468 CCCTACACCTACAAAAAATTAAA 0: 1
1: 1
2: 37
3: 403
4: 3676
Right 1001212085 5:169819485-169819507 GTAGCATGCACCTGTAGTCCCGG 0: 6
1: 91
2: 351
3: 999
4: 2183
1001212080_1001212084 -6 Left 1001212080 5:169819446-169819468 CCCTACACCTACAAAAAATTAAA 0: 1
1: 1
2: 37
3: 403
4: 3676
Right 1001212084 5:169819463-169819485 ATTAAAAAATTAGCTGGTCATGG 0: 8
1: 334
2: 3578
3: 44207
4: 105518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001212080 Original CRISPR TTTAATTTTTTGTAGGTGTA GGG (reversed) Intronic
Too many off-targets to display for this crispr