ID: 1001212084

View in Genome Browser
Species Human (GRCh38)
Location 5:169819463-169819485
Sequence ATTAAAAAATTAGCTGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153645
Summary {0: 8, 1: 334, 2: 3578, 3: 44207, 4: 105518}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001212081_1001212084 -7 Left 1001212081 5:169819447-169819469 CCTACACCTACAAAAAATTAAAA 0: 1
1: 4
2: 96
3: 1298
4: 8442
Right 1001212084 5:169819463-169819485 ATTAAAAAATTAGCTGGTCATGG 0: 8
1: 334
2: 3578
3: 44207
4: 105518
1001212080_1001212084 -6 Left 1001212080 5:169819446-169819468 CCCTACACCTACAAAAAATTAAA 0: 1
1: 1
2: 37
3: 403
4: 3676
Right 1001212084 5:169819463-169819485 ATTAAAAAATTAGCTGGTCATGG 0: 8
1: 334
2: 3578
3: 44207
4: 105518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001212084 Original CRISPR ATTAAAAAATTAGCTGGTCA TGG Intronic
Too many off-targets to display for this crispr