ID: 1001212085

View in Genome Browser
Species Human (GRCh38)
Location 5:169819485-169819507
Sequence GTAGCATGCACCTGTAGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3630
Summary {0: 6, 1: 91, 2: 351, 3: 999, 4: 2183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001212081_1001212085 15 Left 1001212081 5:169819447-169819469 CCTACACCTACAAAAAATTAAAA 0: 1
1: 4
2: 96
3: 1298
4: 8442
Right 1001212085 5:169819485-169819507 GTAGCATGCACCTGTAGTCCCGG 0: 6
1: 91
2: 351
3: 999
4: 2183
1001212082_1001212085 9 Left 1001212082 5:169819453-169819475 CCTACAAAAAATTAAAAAATTAG 0: 25
1: 123
2: 571
3: 3641
4: 5808
Right 1001212085 5:169819485-169819507 GTAGCATGCACCTGTAGTCCCGG 0: 6
1: 91
2: 351
3: 999
4: 2183
1001212080_1001212085 16 Left 1001212080 5:169819446-169819468 CCCTACACCTACAAAAAATTAAA 0: 1
1: 1
2: 37
3: 403
4: 3676
Right 1001212085 5:169819485-169819507 GTAGCATGCACCTGTAGTCCCGG 0: 6
1: 91
2: 351
3: 999
4: 2183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001212085 Original CRISPR GTAGCATGCACCTGTAGTCC CGG Intronic
Too many off-targets to display for this crispr