ID: 1001212086

View in Genome Browser
Species Human (GRCh38)
Location 5:169819494-169819516
Sequence ACCTGTAGTCCCGGCTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 644531
Summary {0: 187, 1: 29475, 2: 149631, 3: 248215, 4: 217023}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001212082_1001212086 18 Left 1001212082 5:169819453-169819475 CCTACAAAAAATTAAAAAATTAG 0: 25
1: 123
2: 571
3: 3641
4: 5808
Right 1001212086 5:169819494-169819516 ACCTGTAGTCCCGGCTACTCAGG 0: 187
1: 29475
2: 149631
3: 248215
4: 217023
1001212080_1001212086 25 Left 1001212080 5:169819446-169819468 CCCTACACCTACAAAAAATTAAA 0: 1
1: 1
2: 37
3: 403
4: 3676
Right 1001212086 5:169819494-169819516 ACCTGTAGTCCCGGCTACTCAGG 0: 187
1: 29475
2: 149631
3: 248215
4: 217023
1001212081_1001212086 24 Left 1001212081 5:169819447-169819469 CCTACACCTACAAAAAATTAAAA 0: 1
1: 4
2: 96
3: 1298
4: 8442
Right 1001212086 5:169819494-169819516 ACCTGTAGTCCCGGCTACTCAGG 0: 187
1: 29475
2: 149631
3: 248215
4: 217023

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001212086 Original CRISPR ACCTGTAGTCCCGGCTACTC AGG Intronic
Too many off-targets to display for this crispr