ID: 1001215884

View in Genome Browser
Species Human (GRCh38)
Location 5:169855385-169855407
Sequence GCCACTTTCCAAAAAGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001215884_1001215894 19 Left 1001215884 5:169855385-169855407 CCTCTGACTTTTTGGAAAGTGGC 0: 1
1: 0
2: 0
3: 22
4: 165
Right 1001215894 5:169855427-169855449 AAGTAGACCAGTAGGAAGTTAGG 0: 1
1: 0
2: 1
3: 9
4: 139
1001215884_1001215892 -4 Left 1001215884 5:169855385-169855407 CCTCTGACTTTTTGGAAAGTGGC 0: 1
1: 0
2: 0
3: 22
4: 165
Right 1001215892 5:169855404-169855426 TGGCAAGGAGATGGGGTTGGGGG 0: 1
1: 2
2: 8
3: 93
4: 895
1001215884_1001215890 -6 Left 1001215884 5:169855385-169855407 CCTCTGACTTTTTGGAAAGTGGC 0: 1
1: 0
2: 0
3: 22
4: 165
Right 1001215890 5:169855402-169855424 AGTGGCAAGGAGATGGGGTTGGG 0: 1
1: 0
2: 2
3: 67
4: 622
1001215884_1001215893 11 Left 1001215884 5:169855385-169855407 CCTCTGACTTTTTGGAAAGTGGC 0: 1
1: 0
2: 0
3: 22
4: 165
Right 1001215893 5:169855419-169855441 GTTGGGGGAAGTAGACCAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 197
1001215884_1001215889 -7 Left 1001215884 5:169855385-169855407 CCTCTGACTTTTTGGAAAGTGGC 0: 1
1: 0
2: 0
3: 22
4: 165
Right 1001215889 5:169855401-169855423 AAGTGGCAAGGAGATGGGGTTGG No data
1001215884_1001215891 -5 Left 1001215884 5:169855385-169855407 CCTCTGACTTTTTGGAAAGTGGC 0: 1
1: 0
2: 0
3: 22
4: 165
Right 1001215891 5:169855403-169855425 GTGGCAAGGAGATGGGGTTGGGG 0: 1
1: 0
2: 7
3: 80
4: 1179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001215884 Original CRISPR GCCACTTTCCAAAAAGTCAG AGG (reversed) Intronic
900241642 1:1620147-1620169 GGACCTTTCCAAAAAGACAGGGG - Intronic
900652474 1:3736736-3736758 GCCAATTTCTAAAAAGACTGAGG - Intergenic
900837423 1:5016047-5016069 GCCACTTTCCAAAGTGTAAGAGG + Intergenic
901732058 1:11287133-11287155 GCCACTTTCCACAGAGCCACAGG + Exonic
904317563 1:29675572-29675594 GCCAGTTTCCAATGACTCAGCGG - Intergenic
904395009 1:30214197-30214219 GACACTTTCCTGAAATTCAGTGG + Intergenic
905256736 1:36689542-36689564 GCCTCTTTCCCAAAAGACAAAGG + Intergenic
907560137 1:55380630-55380652 ATCTCTCTCCAAAAAGTCAGGGG - Intergenic
911363225 1:96905453-96905475 GCCACTTTCTACATATTCAGGGG - Intergenic
912587656 1:110781191-110781213 TCCTCTTTGCAGAAAGTCAGTGG - Intergenic
912975893 1:114329954-114329976 GTTACTTCCCAAAAAGTCAGGGG - Intergenic
914220647 1:145678948-145678970 GCAAGTTCCCAGAAAGTCAGTGG + Intronic
914473226 1:148001818-148001840 GCAAGTTCCCAGAAAGTCAGTGG + Intergenic
920392772 1:205620445-205620467 GACACCTTCCAAAAAGCCACCGG - Exonic
920724530 1:208421637-208421659 GCCTCTCTCCAGAATGTCAGAGG + Intergenic
923359564 1:233197361-233197383 GCCATTTTACCAAAAGACAGTGG + Intronic
923652117 1:235883709-235883731 GCCACCTGCCAAAGAGCCAGAGG - Intergenic
1063697769 10:8353782-8353804 TCAATTTTCCAGAAAGTCAGGGG + Intergenic
1064224289 10:13468928-13468950 GCCTCTTTCTGAAGAGTCAGCGG - Intronic
1064440466 10:15348804-15348826 GCCCCATTCCAAAAAGCCATCGG + Intronic
1067136124 10:43608617-43608639 GCCACATCCCCAAATGTCAGCGG - Exonic
1068026434 10:51651152-51651174 GACAGTTTCCAAGAAGTCAGTGG - Intronic
1073283016 10:102368562-102368584 GCCTCCCTCCAAAAACTCAGGGG - Intronic
1075399515 10:122150886-122150908 GCCACCTTCCGAATAGTCCGTGG - Intronic
1075533813 10:123253906-123253928 GCCAGTTTCCACAGAGCCAGTGG + Intergenic
1075634649 10:124022310-124022332 GCCAGTTTCCAAAAAACCAGGGG + Intronic
1078376565 11:10799205-10799227 GCAACTTCCCAAAAGGTGAGAGG - Exonic
1079460675 11:20675340-20675362 GAAACTTTCCAAAAGGACAGTGG - Intronic
1081069685 11:38595541-38595563 GCCACTTTCCAAGATGGCGGTGG + Intergenic
1081557829 11:44182676-44182698 GCAACTTCCAAAAAATTCAGGGG - Intronic
1081671860 11:44946953-44946975 CCCAATTTCCAGAAAGGCAGAGG + Intronic
1081754806 11:45536949-45536971 GCCATTTTCTAGAGAGTCAGAGG - Intergenic
1083580697 11:63823356-63823378 GCCACTTTAAAAAAAATTAGAGG + Intronic
1083716860 11:64582538-64582560 GCCATTTTTCAGAAAGGCAGTGG + Intergenic
1085115419 11:73927356-73927378 TGCTCTTTCCAAGAAGTCAGAGG - Exonic
1088589163 11:111387974-111387996 CCCACTTCCCACACAGTCAGTGG + Intronic
1090477534 11:127037169-127037191 TCCACTTTCCCTAAAATCAGAGG + Intergenic
1093568166 12:20633637-20633659 TCCTCTTTTCAAAAAGTCATAGG - Intronic
1094544154 12:31388727-31388749 GCCACTTTCAAAAAATAAAGGGG + Intronic
1099573396 12:84354163-84354185 GCCTCTGTCCAGATAGTCAGAGG + Intergenic
1100364363 12:93905504-93905526 GCCCCTGTTCAAAAAGGCAGGGG + Intergenic
1105823333 13:24099431-24099453 GCCACATTCCAAGTCGTCAGTGG + Intronic
1106590585 13:31095267-31095289 TCCCCTCTCCAACAAGTCAGTGG + Intergenic
1106825577 13:33517082-33517104 GCCACTTTAAAAAAAGTAAAAGG - Intergenic
1107328194 13:39268188-39268210 GCTACTTTAGAAAAACTCAGAGG + Intergenic
1108118594 13:47159387-47159409 ACCACTTGCCAAGAAGTCAGTGG + Intergenic
1109356090 13:61231022-61231044 CCCAATTTCCAGAAAGTGAGAGG - Intergenic
1112197318 13:97238588-97238610 GGGACTTTCCCAAAGGTCAGAGG - Intronic
1112343921 13:98575949-98575971 CCCACTCCCCAAAAAGTCACTGG + Intronic
1114785102 14:25587570-25587592 TCCTCTTTTCAAAATGTCAGAGG - Intergenic
1115163366 14:30420435-30420457 CCCACTTTCCATCAAGTCATAGG + Intergenic
1117534903 14:56694489-56694511 GGCAAATTCCGAAAAGTCAGTGG - Intronic
1118726496 14:68632690-68632712 GCAACTGTCCAAAAAGCCTGAGG + Intronic
1119114929 14:72010685-72010707 GTCACCTTCCAATAAATCAGGGG + Intronic
1120729714 14:87989352-87989374 GGCACTTACCAGAATGTCAGTGG - Intronic
1123830699 15:24133442-24133464 GCCAGTTACCAAAAAGTCAAAGG + Intergenic
1123835782 15:24190812-24190834 GCCAGTTACCAAAAAGTCAAAGG + Intergenic
1123845326 15:24294744-24294766 GCCAGTTACCAAAAAGTCAAAGG + Intergenic
1123850950 15:24356208-24356230 GCCAGTTACCAAAAAGTCAAAGG + Intergenic
1123855829 15:24410445-24410467 GCCAGTTGACAAAAAGTCAAAGG + Intergenic
1123860751 15:24464013-24464035 GCCAGTTACCAGAAAGTCAAAGG + Intergenic
1123864368 15:24502626-24502648 GCCAGTTACCAAAAAGTCAAAGG + Intergenic
1124358317 15:29015697-29015719 GCAAGTTTCCAAACAGTGAGTGG - Intronic
1127975199 15:63991897-63991919 GCCCCTGTCCACAAAGTCACAGG + Intronic
1128936671 15:71752120-71752142 GCCACTCTCTGAAAAGGCAGGGG + Intronic
1131309177 15:91272186-91272208 TGCACTTTCCAAAAACTCACAGG - Intronic
1131420092 15:92298115-92298137 TCCACTTTTAAAACAGTCAGTGG - Intergenic
1132763719 16:1524009-1524031 GCCACATTCCAGAATCTCAGCGG - Intronic
1133685833 16:8164848-8164870 CTCACTTTCTAAGAAGTCAGGGG - Intergenic
1136392981 16:29977174-29977196 GTCACTCTCAAAAAAGTCAGGGG - Intronic
1138344675 16:56312593-56312615 GAGTCTTTGCAAAAAGTCAGTGG - Intronic
1138443122 16:57046948-57046970 CCCACTTTCCAGAAAGAAAGGGG + Intronic
1138593959 16:58019411-58019433 GCCACTTGCCCAGAGGTCAGAGG + Intronic
1140253419 16:73314847-73314869 TCCACTTTCCCATAAGTTAGAGG + Intergenic
1145944247 17:28761069-28761091 GTCATTTTCCAAAAAGAAAGAGG + Intronic
1148140905 17:45327574-45327596 GCCTCTTTCTAAAAAGTTAATGG + Intergenic
1148455531 17:47809130-47809152 GCCACTTCCCAAAGAGTCGGTGG + Exonic
1156621175 18:38853841-38853863 GCCATTTTCCCAAATGGCAGTGG - Intergenic
1158083560 18:53623508-53623530 AACCCTTTCCAAAAAGTCAATGG - Intergenic
1159618088 18:70605034-70605056 GCAACTTTGCAAAAAGTAATTGG - Intergenic
1159727426 18:71979250-71979272 TCCACATTCCAAACAGTCTGAGG - Intergenic
1160090153 18:75819241-75819263 CCTACTTTCCAAAAATTCAAGGG - Intergenic
1162829460 19:13275488-13275510 GGGACTTTCCAAAGAGACAGCGG + Intronic
1163627423 19:18398142-18398164 GCCACTGTGCAAGAACTCAGTGG - Intergenic
1164120328 19:22260129-22260151 GCCAGATTCCCCAAAGTCAGAGG + Intergenic
1164890479 19:31819571-31819593 GCCACTTTCCAAAATGCGACAGG - Intergenic
1168385201 19:55957219-55957241 GCCACATTCCAAGAGCTCAGTGG - Intronic
926358665 2:12064743-12064765 GCCACTTTTTAAAAAATCAAGGG + Intergenic
926518622 2:13882098-13882120 GCCAGTTTACAAAAGGTCAGAGG - Intergenic
926837740 2:17043084-17043106 GCCTCTTTCCACAAAGTCCAGGG + Intergenic
929283355 2:40107435-40107457 AACACTTTCCCAAAAGGCAGAGG + Intronic
930670529 2:54145380-54145402 CCCACTTTCCAAACAGGCTGGGG + Intronic
930706641 2:54510987-54511009 CACACTTTCCAGAAAGTCACAGG - Intronic
930906859 2:56579882-56579904 GCACCTTTCTCAAAAGTCAGTGG - Intergenic
933449599 2:82430571-82430593 GTCACTTTCCAAAAAGTTATTGG + Intergenic
935586454 2:104804063-104804085 GCCACTTACCAATCAATCAGAGG + Intergenic
937158223 2:119736559-119736581 AACACAGTCCAAAAAGTCAGAGG + Intergenic
937348013 2:121139538-121139560 GCCATTTTCCAAGATGGCAGAGG - Intergenic
938593748 2:132765904-132765926 TCCACTTTCCAAAAAGTGGGAGG - Intronic
938748015 2:134299200-134299222 ACCAACTTCCACAAAGTCAGTGG - Intronic
939611998 2:144322055-144322077 GACATTTTCCAAATATTCAGAGG - Intronic
940459023 2:153938891-153938913 GCCACATTCCAAAAATCCATGGG - Intronic
940967695 2:159858354-159858376 GCCAAATTCCAAAAGGTAAGTGG - Exonic
941717713 2:168781135-168781157 GTTACGTTCCAAAAAGTCACTGG + Intergenic
942791975 2:179771005-179771027 GACACTTCCCAAAAAGAAAGGGG + Intronic
945316023 2:208371455-208371477 GTCACTTCCCAAACAGCCAGTGG - Intronic
1170788724 20:19490432-19490454 CCCTCTCTCCAGAAAGTCAGGGG - Intronic
1170936432 20:20814109-20814131 GCCACTTTCCTTAGAGTCATTGG + Intergenic
1173705326 20:45106107-45106129 GAGACTTTCCAGAAAGGCAGAGG + Intergenic
1174742992 20:53033964-53033986 GCCACTTTTTAAATAGTAAGAGG + Intronic
1175428571 20:58887698-58887720 GCCAAGTTCAAGAAAGTCAGGGG + Intronic
1176152064 20:63596539-63596561 GCCACGTTCCAGAAAATCAGAGG + Intronic
1182977935 22:34640849-34640871 GCCACTTTCTAGAAAGTCTGGGG - Intergenic
1183612295 22:38917354-38917376 TCCACTTTCCATAGAGTCAGTGG + Intergenic
951153455 3:19320721-19320743 GACACTATCCCAAAAGACAGAGG - Intronic
953335155 3:42088349-42088371 GCCACTTAACAAAAAGGGAGAGG - Intronic
954748298 3:52799360-52799382 CCCACTTTCCAGATAGTCAATGG + Exonic
957125820 3:76158704-76158726 GCCACCTTCCAGAAAGGAAGCGG - Intronic
958097705 3:88968339-88968361 GACACTTTCAAAAAAATCAAAGG - Intergenic
958999157 3:100941468-100941490 GTCACTTTACAAAAAGTCCAAGG + Intronic
959344077 3:105170826-105170848 TATACTTTACAAAAAGTCAGTGG - Intergenic
965659356 3:171024583-171024605 GCAACTTTGGAAAAAGCCAGGGG + Intronic
975646383 4:76549989-76550011 GCCAATTTCCAGCAAGTCAAAGG - Intronic
976606982 4:86993115-86993137 GCTGCCTTCCAAAAAGTTAGGGG - Intronic
977249488 4:94674129-94674151 GCCACTTTCCTGAGTGTCAGGGG - Intergenic
979804394 4:124952691-124952713 GCCACTTTTCAAATACTCAATGG + Intergenic
982541177 4:156673589-156673611 CCCACTTTCCAAAATTTCAGTGG - Intergenic
983739415 4:171109819-171109841 GCAAATTTCCACAAATTCAGTGG - Intergenic
983839904 4:172444450-172444472 ACCAATTTACAAAAAGTCATTGG - Intronic
984426412 4:179592600-179592622 GCCACATTTCTAAAAGTCAAAGG - Intergenic
984471157 4:180176145-180176167 GCCATTTTCCAGACAGTCAATGG + Intergenic
984684741 4:182654559-182654581 GATATTTTGCAAAAAGTCAGAGG - Intronic
985553690 5:545890-545912 GCCACATTCTGCAAAGTCAGTGG - Intergenic
986323846 5:6656832-6656854 GCCACGTTCCACAGAGTAAGAGG + Intronic
987256209 5:16154586-16154608 GCCACCTCCCAAAAAGGGAGGGG + Intronic
987293965 5:16533849-16533871 TCCACTTTCCAAAATAGCAGTGG - Intronic
991122380 5:63031489-63031511 GCCACTTTCAAAAAATCCATGGG + Intergenic
997712661 5:136018910-136018932 GAGACTTTCCCAAAAGTCAAAGG + Intergenic
997877023 5:137558724-137558746 ACCAATTTCCAACAACTCAGGGG - Intronic
998087964 5:139342115-139342137 GCCTCTTTCCACCAAGTCTGAGG + Intronic
999873804 5:155780235-155780257 GCCACTTTTTAAAAAGACACTGG + Intergenic
1000611067 5:163375610-163375632 CCCACTTTCCAAATACACAGAGG + Intergenic
1000666392 5:164003050-164003072 AGCACTTTCCAAAAAGTCCTGGG + Intergenic
1000855395 5:166391858-166391880 GCCACTTACCTAAAAGACTGTGG + Intergenic
1001215884 5:169855385-169855407 GCCACTTTCCAAAAAGTCAGAGG - Intronic
1001480547 5:172086306-172086328 CCCACTTTCCAGAAAAGCAGAGG - Intronic
1005276346 6:24223017-24223039 TCTCCTTTTCAAAAAGTCAGTGG + Intronic
1007295416 6:40817196-40817218 GCCCCTTTCCAAGGAGTCATTGG + Intergenic
1012831140 6:104204700-104204722 CCCTCCTTCCAAAAAGTCAGGGG + Intergenic
1012854534 6:104486542-104486564 TCCACTCACCAAAAAGTCATAGG + Intergenic
1017845892 6:158258057-158258079 GCCTCTTTCAAAACAATCAGCGG + Intronic
1017873196 6:158503198-158503220 GCCACTTTCCAAACAGGCTATGG + Exonic
1018456966 6:163961733-163961755 ACCACCTTCCCAAAATTCAGTGG + Intergenic
1019653918 7:2177506-2177528 GCCTGTTTCAAAGAAGTCAGTGG - Intronic
1019854710 7:3593221-3593243 GCCACTTTTCAAAAGTCCAGAGG - Intronic
1020810977 7:12849560-12849582 GCAACTTTGCAAAAAATCAGTGG - Intergenic
1025774177 7:64544407-64544429 GCCACATCCCTAAATGTCAGTGG + Exonic
1025816486 7:64917584-64917606 GCCACATCCCTAAATGTCAGTGG - Exonic
1026116585 7:67501023-67501045 CCCAGTTTGCAAGAAGTCAGAGG + Intergenic
1026796165 7:73367314-73367336 GCCTCTTTCCAAAACAGCAGAGG + Intergenic
1027128055 7:75571233-75571255 CCCATTTTACAAAAAGGCAGTGG + Intronic
1027415751 7:77972676-77972698 GCCACTTTACAAAACTTGAGGGG - Intergenic
1028163319 7:87510129-87510151 ACCACTTGCCACAAATTCAGTGG - Intronic
1028312017 7:89350492-89350514 ACCACTTTCCTAGAAATCAGAGG - Intergenic
1029610260 7:101622845-101622867 GCCACTGTCTGGAAAGTCAGGGG - Intronic
1031543020 7:123018450-123018472 GCCACATTTCAAAAATTCACAGG - Intergenic
1036220311 8:6915756-6915778 GCCATGTACCAAAAAATCAGGGG + Intergenic
1038386528 8:27153076-27153098 GCCACTTTTCAACAAGTGTGTGG - Intergenic
1039374798 8:37022697-37022719 CCCACTTTCTGAAAATTCAGTGG + Intergenic
1042860686 8:73310124-73310146 GCAACTTTCCTATAAATCAGTGG - Intronic
1045970362 8:108072985-108073007 GCCACTTTGAAAAACATCAGTGG - Intronic
1047723200 8:127661523-127661545 TCAACTTTCTGAAAAGTCAGTGG - Intergenic
1047948367 8:129905738-129905760 GCCACTTTGCATAAAATCATGGG + Intronic
1048705317 8:137147050-137147072 GCCACCTCCCAGAAAGACAGGGG + Intergenic
1050032846 9:1404588-1404610 GCCACCTGCCAAAAAGTCTGTGG - Intergenic
1056833093 9:89932298-89932320 GCCCATTTCCAAAAAGGCAAAGG + Intergenic
1056953363 9:91063484-91063506 CCCAATTTCCAAAACATCAGTGG + Intergenic
1059247196 9:112858583-112858605 GACACTATCCAAAAAATCAAAGG + Intronic
1062307253 9:135915036-135915058 GCAAATTACCAAAAATTCAGTGG - Intergenic
1188312676 X:28636889-28636911 GACACTTTACACAAAATCAGAGG + Intronic
1189202868 X:39212697-39212719 GCCAGTTTCCCCAAAGTCTGAGG + Intergenic
1190797959 X:53761378-53761400 GCCACTTCTCAAAAGGTGAGCGG - Intergenic
1190917200 X:54819832-54819854 GCCACTTCTCAAAAGGTGAGTGG + Intergenic
1194748426 X:97656048-97656070 TCTTCTTTCCAAAAAGTGAGAGG + Intergenic
1195535713 X:106007198-106007220 GCCACTTCCCAATAACTCATTGG + Intergenic
1195678991 X:107529665-107529687 GCCACTGTCCAATAAATGAGGGG - Intronic
1198080901 X:133238467-133238489 GCTATTTTCCAAAATGACAGAGG + Intergenic
1199448293 X:147952464-147952486 TGCAGTTTCCAAAAAGCCAGAGG - Intergenic