ID: 1001217880

View in Genome Browser
Species Human (GRCh38)
Location 5:169872802-169872824
Sequence GTGATCTGCCCAAGATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 425}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001217880_1001217885 18 Left 1001217880 5:169872802-169872824 CCCTGGGATCTTGGGCAGATCAC 0: 1
1: 0
2: 6
3: 64
4: 425
Right 1001217885 5:169872843-169872865 AGTTTCCTCATCTGTAAAATGGG 0: 580
1: 3018
2: 7778
3: 13577
4: 18950
1001217880_1001217884 17 Left 1001217880 5:169872802-169872824 CCCTGGGATCTTGGGCAGATCAC 0: 1
1: 0
2: 6
3: 64
4: 425
Right 1001217884 5:169872842-169872864 CAGTTTCCTCATCTGTAAAATGG 0: 714
1: 3520
2: 8648
3: 15140
4: 20726

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001217880 Original CRISPR GTGATCTGCCCAAGATCCCA GGG (reversed) Intronic
901010290 1:6197501-6197523 GTAATCTGCCCACATTCCCAGGG + Intronic
901152368 1:7112467-7112489 ATGAGCTGCCCAAGGTTCCATGG + Intronic
901878294 1:12179508-12179530 GGTATCTGCCCAAGGACCCAGGG - Intronic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902479486 1:16704233-16704255 GTGGCTTGGCCAAGATCCCACGG - Intergenic
902677652 1:18019997-18020019 GTGACTTGCACAACATCCCACGG - Intergenic
902695425 1:18137514-18137536 GTCACTTGCCCAAGATCCCGTGG + Intronic
903010131 1:20323985-20324007 GTCACCTGCCCAAGGTCACATGG + Intronic
903186457 1:21632053-21632075 GTGACCCGCCCAAGGTCACATGG + Intronic
903250777 1:22052017-22052039 GTGACTTGCCCCAGATCACAGGG - Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903569377 1:24293206-24293228 GTAATCTGCTCAAGGTCACAGGG - Intergenic
903708953 1:25307633-25307655 GTTATCTGCCCAAGGTCACTCGG + Exonic
903718167 1:25384785-25384807 GTTATCTGCCCAAGGTCACCCGG - Intronic
903742202 1:25564875-25564897 GTGACTTGCCCAAGGTCTCACGG + Intronic
903859491 1:26356313-26356335 ATGATCTGCCCAGGGTCACATGG + Intergenic
903925913 1:26830321-26830343 GTAATCTGCCCAAGGTCACATGG - Intronic
904405923 1:30287856-30287878 GTGATTTGTCCAAGGTCACAGGG + Intergenic
904748324 1:32725091-32725113 GTGATCGGCCCTACTTCCCAGGG + Intergenic
905043442 1:34978154-34978176 GTAATTTGCCCAAGGTCACATGG - Intergenic
905405198 1:37727741-37727763 ATAATTTGCCCAAGATCACATGG + Intronic
905788909 1:40779803-40779825 GTGACTTGCCCAAGGTCCCCAGG + Intergenic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906808517 1:48803095-48803117 GTAATGTGCCCAAGGTCACATGG + Intronic
906912777 1:49972993-49973015 CTAACCTGCCCAAGATCACATGG + Intronic
907309472 1:53531043-53531065 GTGACCTGCCCAAGGTCACAGGG + Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
908217669 1:61971175-61971197 GTGAACTGCCCAGGATTTCATGG + Intronic
908805654 1:67928701-67928723 GTTATTTGCCAAAGATCACATGG + Intergenic
908823368 1:68111402-68111424 GTGATTTGGCCAAGACCACAAGG - Intronic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
910643605 1:89490109-89490131 GTGATCTCCCCCATAACCCAGGG - Intergenic
910840659 1:91558049-91558071 GTAATTTGCCCAAGATCTCTTGG - Intergenic
911446639 1:98002163-98002185 GTCATCTTCCAAGGATCCCAGGG - Intergenic
914676839 1:149912592-149912614 GAGACCTGTCCAAGACCCCATGG + Intronic
915146589 1:153799302-153799324 ATGACCTGCCCAAAGTCCCATGG - Intergenic
915667672 1:157459646-157459668 GTCATCTGCCAAAGATGGCAAGG + Intergenic
918084848 1:181236900-181236922 GTGATTTGTGCAAGATCACATGG - Intergenic
919469430 1:197959913-197959935 TTGACCTGCCAAAAATCCCAAGG - Intergenic
919725735 1:200882056-200882078 GTGATCTGAGGAGGATCCCAAGG - Intergenic
920372049 1:205485262-205485284 GTGACTTCTCCAAGATCCCACGG - Intergenic
920447310 1:206028464-206028486 GTGATCAGCCCAAGAGCACATGG + Intergenic
920712058 1:208304558-208304580 ATAATGTGCCCAAGATCACACGG - Intergenic
921315129 1:213883191-213883213 AAGATCTGCCCAAGTTCACACGG - Intergenic
922235689 1:223720977-223720999 GTCACCTGCCCAAGTTCCCTGGG - Intronic
923218941 1:231875493-231875515 GTGAATTGCCCAAGTACCCAAGG - Intronic
1062788059 10:281693-281715 CTCGTCTGCCCAAGATCACACGG + Intronic
1064209574 10:13350948-13350970 GTGATATGCCCTAAATCCTATGG + Intergenic
1065809429 10:29427745-29427767 GTGCTCTGCCCTTGCTCCCAAGG - Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067167237 10:43875019-43875041 GTGAGCTGCCCCATATCACACGG - Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1068605976 10:59005468-59005490 GTGATTTGCCCAAGGTTACAGGG + Intergenic
1069448787 10:68499192-68499214 GTGATCTGCCCATGGTCAAAGGG + Intronic
1070567804 10:77616912-77616934 GTGGCTTGCCCAAGATCCAAAGG + Intronic
1070578961 10:77704330-77704352 CTGATAAGCCCAAGATCCCCTGG - Intergenic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1071426505 10:85560023-85560045 ATGATCTGCCCATGATGACAAGG - Intergenic
1071601526 10:86960920-86960942 TTAATGTGCCCAAGGTCCCATGG + Intronic
1072048785 10:91683003-91683025 ATCATGTGCCCAAGATCACATGG + Intergenic
1073064715 10:100751184-100751206 GTGATTGTCTCAAGATCCCAAGG - Intronic
1073511131 10:104043225-104043247 ATGACTTGCCCAAGGTCCCACGG - Intronic
1074517099 10:114180356-114180378 GTGATTTGCCCAAGATAGCGTGG + Intronic
1076391945 10:130110137-130110159 GAGACTTGCACAAGATCCCAGGG - Intergenic
1077093295 11:789127-789149 GTGACCTGGCCAGGGTCCCAGGG + Intronic
1077736774 11:4799936-4799958 GTGGACTTCCCAAGCTCCCAAGG - Intronic
1077911708 11:6577858-6577880 GTAAACTGCCCAAGGTCACACGG + Intronic
1078031625 11:7757720-7757742 GTGATCAGCTCAAGATCTGAAGG - Intergenic
1078177324 11:8979597-8979619 GAAATCTGCCCAAGGTCCCCTGG - Intergenic
1078477278 11:11641701-11641723 GTGATTTGCCTAAAATCACATGG - Intergenic
1078737574 11:14034662-14034684 GAACTCTGACCAAGATCCCAGGG - Intronic
1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG + Intronic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1080694338 11:34588245-34588267 GTAATTTGCCCAAGGTCACATGG - Intergenic
1081304770 11:41498320-41498342 GTTATCTGCCAGAGATTCCATGG - Intergenic
1081807701 11:45899476-45899498 GGGATCTGTCCAAGGTGCCAGGG + Intronic
1083739971 11:64703918-64703940 GTTAACTGCCCAAGTTCACACGG + Intronic
1083870759 11:65487066-65487088 GTGACCTGCTGAAGGTCCCAGGG + Intergenic
1085393960 11:76196904-76196926 GTGATGTGCCCAAGGTCACATGG - Intronic
1085510035 11:77083493-77083515 GTGACCTGCCCAAGCTCCCCTGG - Intronic
1085730173 11:78991187-78991209 CTGTCCTGCCCAAAATCCCAGGG + Intronic
1085747568 11:79128211-79128233 GTTATCTGCAGAAGATGCCAGGG - Intronic
1086851375 11:91813120-91813142 GTTATGTGCCCAAGATAACAGGG - Intergenic
1089072873 11:115714942-115714964 GTGATTTGCCTAAGATCGTATGG - Intergenic
1089150575 11:116360636-116360658 GTGACCAGCCCAAGCTGCCAGGG - Intergenic
1089159287 11:116425063-116425085 GTGAATTGCCCAAGGTCACAGGG + Intergenic
1089270609 11:117299376-117299398 GTGATCTGCTCAAGGTGACAGGG - Intronic
1089685871 11:120146567-120146589 GTAACCTGCCCAAGGTCACAAGG + Intronic
1090228830 11:125087442-125087464 GTGCTATGCCCAAGGTCTCATGG - Intronic
1090249111 11:125238900-125238922 GAGATGTGCCCAGGATCACAGGG - Intronic
1090499678 11:127249158-127249180 GTGATTTGCACAAGCTCACATGG - Intergenic
1090828161 11:130402401-130402423 GTGCTCTGCCCCAGATCACCAGG - Intergenic
1091039684 11:132265364-132265386 GTAATTTGCCCAAAATCTCATGG - Intronic
1091684659 12:2553139-2553161 GTGCTTTGGCCAAGATCCCAGGG - Intronic
1091930232 12:4390042-4390064 GTGATTTGCCCAAGGTTACACGG + Intergenic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092084131 12:5741813-5741835 GTAATCTGCCCAAGGTAACAGGG + Intronic
1092225636 12:6746516-6746538 GTGACCTGCCCAAGACCACAAGG + Intergenic
1092825194 12:12392277-12392299 GTGACTTGACCAAGATCCTAAGG + Intronic
1092914157 12:13174493-13174515 GTGTTGGGCCCAAGATCACAGGG - Intergenic
1092963589 12:13619801-13619823 ATGACTTGCCCAAGCTCCCACGG + Intronic
1092964888 12:13631982-13632004 GTGGTCTGGCCATGAACCCAAGG - Intronic
1093246031 12:16737796-16737818 GTTATTTGCCCAAAATTCCATGG - Intergenic
1094299647 12:28948424-28948446 GTGATTTGCCCAAGGTCACATGG + Intergenic
1095456470 12:42391050-42391072 TTGATTTGCCCAAGGTCACATGG + Intronic
1095980417 12:47970657-47970679 GTGATTTGCACAGGATCCAAGGG + Intergenic
1096105544 12:48995309-48995331 GTGATGTGGCCAAGTTCACATGG + Exonic
1097337868 12:58404755-58404777 GTGATTTGCCTAAGGTCACATGG + Intergenic
1098146743 12:67505199-67505221 GTCTCTTGCCCAAGATCCCACGG + Intergenic
1098885675 12:75958385-75958407 GAACTCTGCCCAAGTTCCCATGG - Intergenic
1098885695 12:75958730-75958752 GAAACCTGCCCAAGTTCCCATGG + Intergenic
1098964702 12:76774660-76774682 GTAATTTGCCCAAGATCATATGG - Intronic
1100461192 12:94800838-94800860 GCGACTTGCCCGAGATCCCATGG - Intergenic
1100657186 12:96659756-96659778 GTGACCTGCCCAAGGGCCCCTGG + Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1100898955 12:99216322-99216344 GTAATATGCCCAGGGTCCCAGGG - Intronic
1101210461 12:102530412-102530434 GTGACTTGCCTAAGATCACAAGG + Intergenic
1101312920 12:103600005-103600027 GTAATTTGCCCAAGATTACATGG - Intronic
1101579515 12:106030394-106030416 GTAAACGGCCCAAGATCACAGGG + Intergenic
1101613188 12:106310638-106310660 GTGACCTTCCCAAGGTCTCATGG + Intronic
1101747845 12:107557793-107557815 CTAATTTGCCCAAGATCACAGGG + Intronic
1101985462 12:109442623-109442645 GTGACCTGCCCAGGATCTCACGG - Intronic
1102193435 12:111006766-111006788 GTGATTTGCCCAAGATCACATGG - Intergenic
1102267824 12:111503336-111503358 GTAATCTGCCCAAACTCACATGG - Intronic
1102577327 12:113864109-113864131 GTGACTTGCCCAAGGTTCCATGG + Intronic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102797487 12:115701217-115701239 TTGATCTGCCTAAGATCTGATGG + Intergenic
1102978119 12:117221042-117221064 CAGACCTCCCCAAGATCCCATGG + Intronic
1104044877 12:125154640-125154662 GGAACTTGCCCAAGATCCCATGG + Intergenic
1104360921 12:128132509-128132531 GTGGCCTGTCCAAGATCACACGG + Intergenic
1109716024 13:66223471-66223493 GTAACCTGTCCAAGATCACATGG - Intergenic
1111897484 13:94159176-94159198 GTGATATGCCCAATGTCTCAGGG - Intronic
1112221138 13:97492262-97492284 GTGATCTGCCCTTGACCTCACGG + Intergenic
1112508525 13:99989655-99989677 GTGATCTGCCCTTGATCTCAGGG - Intergenic
1113316153 13:109181661-109181683 GTGATTTGCCAAAGATCATATGG + Intronic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1113648857 13:112019374-112019396 ATGAACTTCCCAAGTTCCCATGG + Intergenic
1114131034 14:19792929-19792951 ATGACCTTCCCAAGATCTCAGGG + Intronic
1114666921 14:24383306-24383328 GTGAGCTACCCAAGAAGCCAGGG + Intergenic
1114697527 14:24640894-24640916 GTGATGTGCCCCAGGTCACATGG + Intergenic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1115667425 14:35567524-35567546 GTGACTTGGCCAAGATCACAAGG + Intronic
1116020685 14:39456529-39456551 GTGATCTTCCCAATAACCCTAGG - Intergenic
1117001596 14:51376284-51376306 GTTATCTGCAGAAGATCACAGGG - Intergenic
1117457597 14:55913473-55913495 GTGACTTGCCCAAGATCTCACGG + Intergenic
1118649692 14:67877329-67877351 GTGATTTGCCCAAGATCATATGG + Intronic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119732361 14:76958895-76958917 GTGATTTGCCCAAGGCCACACGG - Intergenic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120845976 14:89125590-89125612 TTAATTTGCCCAAGATCACATGG + Intronic
1121033148 14:90676392-90676414 GTGACTGGCCCAAGATCACATGG + Intronic
1121042029 14:90757550-90757572 ATGATTTGCCCAAGGTCACATGG + Intronic
1121429245 14:93875060-93875082 GTGACCTCCCCAAGGTCACATGG - Intergenic
1121572409 14:94956856-94956878 GTGATCGGCCCAAGGTCACTCGG + Intergenic
1122145254 14:99684840-99684862 GTCACCTGCCCAAGGTCACACGG + Intronic
1123610712 15:22091141-22091163 ATGACCTTCCCAAGATCTCACGG + Intergenic
1124625489 15:31305182-31305204 GTGAGCTGCGCCAGAACCCAGGG - Intergenic
1124637569 15:31374722-31374744 GTGATCTGCCCAGGGTGTCACGG + Exonic
1124713012 15:32030682-32030704 GGGATGTGCCCGGGATCCCACGG - Exonic
1126699680 15:51356661-51356683 GTGACCTGCCGAAGGTCACACGG - Intronic
1127785681 15:62352823-62352845 GTAATTTGCCCAAGATCACATGG - Intergenic
1128943463 15:71806738-71806760 CTGACCTGCCAAAGAACCCAGGG + Intronic
1129788932 15:78327833-78327855 GTGACTTACCCAAGGTCCCATGG - Intergenic
1130106688 15:80933727-80933749 GTAATTTGCCCAAGGTCCAATGG - Intronic
1131439891 15:92451802-92451824 GTAACTTGCACAAGATCCCACGG + Intronic
1202982960 15_KI270727v1_random:382902-382924 ATGACCTTCCCAAGATCTCACGG + Intergenic
1133101124 16:3480664-3480686 GTGATCTGCCCAAAATGCCGGGG - Intronic
1133475656 16:6119065-6119087 ATGACCCACCCAAGATCCCATGG - Intronic
1133507775 16:6429293-6429315 GGGAGCTGGCAAAGATCCCAGGG - Intronic
1134372991 16:13643024-13643046 GTGAACTGCTCAAGGTCACATGG - Intergenic
1134541404 16:15069634-15069656 GTCATTTTCCCAAGATCACATGG - Intronic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1134763926 16:16739172-16739194 GCAACCTGCCCAAGATCCCCAGG - Intergenic
1134982128 16:18619991-18620013 GCAACCTGCCCAAGATCCCCAGG + Intergenic
1135001907 16:18783830-18783852 GTGACTTGCCCAAGATCTCATGG + Intronic
1135166528 16:20144013-20144035 GTGATTTGCCCAAGGTCACGTGG + Intergenic
1135176075 16:20230460-20230482 GTGACTGGCCCAAGATCCCATGG - Intergenic
1135359392 16:21799214-21799236 GTCATTTTCCCAAGATCACATGG - Intergenic
1135436859 16:22434191-22434213 GTCATTTTCCCAAGATCACATGG - Intronic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1136035290 16:27534663-27534685 GTGCTCAGCCCAAGAACACAGGG - Intronic
1136263401 16:29097730-29097752 GTCATTTTCCCAAGATCACATGG + Intergenic
1136402435 16:30025860-30025882 GGGGGCTGCCCAAGAACCCAGGG - Intronic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137790023 16:51167066-51167088 ATGACCTGCCCAAGGTCACATGG - Intergenic
1137816929 16:51407118-51407140 ATGACCTGCCCAAGGTCACATGG + Intergenic
1137829729 16:51532984-51533006 GTGACTTGCCTAAGATCACAGGG + Intergenic
1138345710 16:56318944-56318966 GTGTTCTGTCCAAGGTCACATGG + Intronic
1138440695 16:57033350-57033372 GTGATTTGCCCAAGGCCACATGG + Intronic
1138480267 16:57298126-57298148 GTGATCTACCCAAGGTCACACGG + Intergenic
1138944598 16:61833043-61833065 GTGACCTGCCCACGATCACATGG - Intronic
1139214424 16:65113383-65113405 AGGACTTGCCCAAGATCCCACGG - Intronic
1139239253 16:65373784-65373806 GTGAGCTGCCCAAGCTTGCAGGG + Intergenic
1139465452 16:67151537-67151559 GTGACTTGCCCAGGATCCAAAGG + Intergenic
1139991588 16:70944019-70944041 GTGATCTTCCCAAGGTCCTGTGG - Intronic
1140378308 16:74463268-74463290 GTGACCTGCTCAAACTCCCAGGG - Intronic
1140432742 16:74918802-74918824 ATGATCTGTCCAAGGTCACAGGG + Intronic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140477841 16:75247875-75247897 GTTCTCTGCCCAAGACCCCAGGG + Intronic
1140722919 16:77787658-77787680 ATGAGTTGCCCAAGATCTCAAGG + Intergenic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1142824742 17:2502076-2502098 GTGATTTGTCCAAGGTCGCATGG + Intronic
1142954826 17:3514526-3514548 TTGATCTGCCCAAGGTTACATGG + Intronic
1143014149 17:3882833-3882855 GGGATGTTCCCAAGTTCCCATGG - Intronic
1143087571 17:4427595-4427617 GTGATCTGCCTGAGATCCTATGG + Intergenic
1144242465 17:13326759-13326781 TTTATCTGCCCAAGACCCTATGG - Intergenic
1146266989 17:31459285-31459307 GTGCTTTGCCCAAGACCACATGG - Intronic
1147499890 17:40952914-40952936 GTAACTTGCCCAAGATCTCATGG + Intergenic
1147807548 17:43142536-43142558 GTGACCTGCCCAAGTGTCCAAGG - Intergenic
1148383427 17:47217552-47217574 ATGATTTGGCCAAGATCACATGG + Intronic
1148987670 17:51637738-51637760 GTGGGCTGCCCAAGGTCACAGGG + Intronic
1149599739 17:57885649-57885671 GTGAGCTGCCCGAGACCGCAGGG - Exonic
1150142872 17:62744704-62744726 GTGATTTTCCCAAGCTCACATGG - Intronic
1150793213 17:68216506-68216528 TTGATTTGCCCAAGATCCTATGG + Intergenic
1150841723 17:68613915-68613937 TTGATCTGTCAAAGAGCCCATGG + Intergenic
1151346868 17:73507704-73507726 GTAATTTGCCCAAGGTCCCGTGG + Intronic
1152295856 17:79466508-79466530 GTGACCCTCCCAAGGTCCCAGGG - Intronic
1152997993 18:426055-426077 GTGACTTGTCCAAGATCACATGG + Intronic
1153097073 18:1419318-1419340 CTGAGCTGCCCACTATCCCAAGG + Intergenic
1154102610 18:11489919-11489941 GTCACCTGCCCAAGATGCCTAGG + Intergenic
1157100320 18:44723461-44723483 GTGATTTGTTCAAGATCACATGG + Intronic
1157612474 18:48966615-48966637 GTGATGTGTCCAAGGTCACAAGG - Intergenic
1158520461 18:58168394-58168416 GGGATTTGCCCAAGATAGCATGG - Intronic
1159016691 18:63106566-63106588 GTGATCTGGCCATGACCCCCAGG - Intergenic
1160233222 18:77064991-77065013 GTGACTTGCCCAAGACCACAGGG - Intronic
1160958738 19:1707636-1707658 GGGAGCTGCCCTACATCCCAAGG + Intergenic
1161261442 19:3340034-3340056 GCCATCTGCCCAAGGTCCCGTGG + Intergenic
1163383146 19:16981804-16981826 ATGATTTGCCCAAGCTTCCACGG - Intronic
1164628253 19:29743704-29743726 GTGATCTGGCCATGAAACCAGGG + Intergenic
1164796000 19:31030783-31030805 GTAATGTGCCCAAGGTCACATGG - Intergenic
1164863479 19:31582351-31582373 TTGATCTATGCAAGATCCCATGG - Intergenic
1166092301 19:40517838-40517860 ATGATTTGCCCAAGGTCACATGG + Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
1166873849 19:45885709-45885731 GCGACCTGCCCAAGATGCCGTGG - Exonic
1202713525 1_KI270714v1_random:30139-30161 GTGGCTTGGCCAAGATCCCACGG - Intergenic
925364726 2:3304157-3304179 ATGATCTTCCCAAGACCCCACGG + Intronic
925634865 2:5933339-5933361 GTGATTTGCCCAACACCACAGGG - Intergenic
927915656 2:26934447-26934469 GGGACCTGCCCAAGCTCACAGGG - Intronic
929536311 2:42786614-42786636 GTGCCCTGTCCAAGATCCCGGGG + Intronic
929598612 2:43191373-43191395 GTGACCTGCCCAAGGTCACTGGG + Intergenic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930152852 2:48076192-48076214 GTGATTTTCCAAAGATCACATGG - Intergenic
930910147 2:56620867-56620889 GTTATCTGCAGAAGATGCCAGGG - Intergenic
931185038 2:59941660-59941682 GTGATTAGCCCAAGGTCACATGG + Intergenic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
931619491 2:64195400-64195422 GTAACCTGCCCAAGGTCCCCAGG - Intergenic
931919380 2:66996607-66996629 GTGACATGGCCAAGATCACATGG + Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932691811 2:73919980-73920002 GTGAACTGCCCTAGAGCACAAGG - Intergenic
933183953 2:79258325-79258347 GGGAACTGCCCAAGGTCGCATGG - Intronic
933782804 2:85813664-85813686 GTGATTTGTCCAAGACCTCATGG - Intergenic
934579982 2:95430055-95430077 GTGACCTTCCCCAGATCCCAAGG - Intergenic
934599465 2:95646670-95646692 GTGACCTTCCCCAGATCCCAAGG + Intergenic
935125005 2:100215181-100215203 ATAATGTGCCCAAGGTCCCATGG - Intergenic
935311327 2:101786723-101786745 GTTATCTGCCCACGATACAATGG - Intronic
936246082 2:110828710-110828732 GTCATTTGCTCAAGATCACATGG + Intronic
936469676 2:112787928-112787950 GCAATCTGCCCAAGATTGCAAGG + Intergenic
938341871 2:130541244-130541266 GTGCTCTGCCCATGATGTCAGGG - Intronic
938347959 2:130579467-130579489 GTGCTCTGCCCATGATGTCAGGG + Intronic
938580347 2:132640004-132640026 GTGATTTGCCCAAGATCTCCTGG - Intronic
938807633 2:134821548-134821570 GTGAGCTGCTCAAGGACCCATGG - Intergenic
939788689 2:146546143-146546165 GTTATCTGCAGAAGATGCCAGGG + Intergenic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
941751457 2:169139250-169139272 CTGCTCTGCCCAAGCTGCCAAGG - Exonic
941923233 2:170872036-170872058 GTGATGTGCCAAAGGTCCCCCGG - Intergenic
943619738 2:190135635-190135657 ATGATCTGCCCAAGGTAACACGG - Intronic
944411038 2:199442315-199442337 GTGATCTGGCCAACATCCCCTGG - Intronic
944635969 2:201676406-201676428 GAGATTTGTCCAAGATCCTAAGG - Intronic
945340194 2:208643497-208643519 GTAATAAGCCCAAGATCACATGG + Intronic
945503459 2:210607673-210607695 GTGATGTGCTCAAAATCACACGG - Intronic
945922213 2:215766595-215766617 GTGATCTGCTCAAGATCTCTTGG - Intergenic
946458119 2:219845639-219845661 ATGACCTGCCCAAGGTCACATGG - Intergenic
946464564 2:219900254-219900276 GTGATCTGAGCTAGATCCCCTGG + Intergenic
948356927 2:237385515-237385537 ATGACCTGCCCAGGATCACATGG + Intronic
948378877 2:237539775-237539797 GTGACCTGCCGAAGGTCACATGG + Intronic
1168833478 20:860521-860543 GTGATTTGCCCAAGGTCACATGG - Intergenic
1168891431 20:1297373-1297395 ATGATCTGCTCAAGGTCACACGG - Intronic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1169304356 20:4475477-4475499 GTGAGCTGCCCAAGGTCACTAGG - Intergenic
1170485694 20:16813652-16813674 GAGAACTGCTCAAGATCCAACGG - Intergenic
1170509445 20:17061361-17061383 GTGCCTTGGCCAAGATCCCAAGG + Intergenic
1172114601 20:32566223-32566245 GTGATTTGCCTAAGATCACATGG + Intronic
1172145164 20:32752424-32752446 GTGACATGCCCAAGACCCCAGGG - Intergenic
1172239217 20:33401227-33401249 GTGACCTGTCCAAGGTCACACGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172916351 20:38446814-38446836 GTGGTCTTCCCAAGAACCCCTGG + Intergenic
1173055901 20:39612419-39612441 GAGATCTGCCCAAGGTCCTCTGG - Intergenic
1173161477 20:40655897-40655919 GTGATTTGCCCAAGACCCCATGG + Intergenic
1173468025 20:43299838-43299860 ATAACTTGCCCAAGATCCCATGG + Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174458215 20:50664586-50664608 GTGATTTGCCCAATGTCACACGG - Intronic
1174657093 20:52180812-52180834 GTAACCTGCCCAAGGTCACATGG + Intronic
1174858572 20:54069192-54069214 GTGATCAGCTCAGGATCCCCAGG + Intronic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1178716138 21:34966169-34966191 TTAATTTGCCCAAGATCACAAGG + Intronic
1178851364 21:36215219-36215241 GTGGCTTGCCCAGGATCCCAAGG - Intronic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179224379 21:39440706-39440728 GTGATCTTCTCAAGTGCCCATGG - Intronic
1179326623 21:40352742-40352764 GTGAATTACCCAAGATCACATGG - Intronic
1179580357 21:42339499-42339521 GTTAACTGCCCAGCATCCCATGG + Intergenic
1180143331 21:45906298-45906320 CTGATCTGCCGAAGACCTCAGGG - Intronic
1180927480 22:19566365-19566387 GTAAACTGCCCAAGGTCACAGGG + Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181531062 22:23517789-23517811 GTGATCGGCCCAAGGTCACCTGG + Intergenic
1181879266 22:25964816-25964838 GTGCTGTGCCCAAGGTCGCAGGG + Intronic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182341352 22:29623809-29623831 GTGATGCGCCCAAGGTCACACGG - Intronic
1182348123 22:29681275-29681297 GTGACCAGCCCAAGCTCCCATGG + Intronic
1182442974 22:30374858-30374880 GTGAGCTGTCCAAGGTCACACGG - Exonic
1182766673 22:32762575-32762597 GTGACCTCCCCAAGGTCTCATGG - Intronic
1182894105 22:33844643-33844665 GTGATATACCCAAGTTCGCACGG - Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183003152 22:34878374-34878396 GTCATTTGCCCAAGGTCACATGG - Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183467908 22:37989154-37989176 GTGATCTGCCTAAGGCCCCTTGG - Intronic
1184271494 22:43387073-43387095 GTGACCTGCCCAAGGGCACAAGG + Intergenic
1184508398 22:44917801-44917823 GTGACCTGCCCAAGGCCACAGGG - Intronic
949856431 3:8466103-8466125 GTGATCTACCCAAGGTCACACGG + Intergenic
949926783 3:9048074-9048096 GTGATTTGTCCAAGGTCCCACGG + Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
950789404 3:15460561-15460583 GAGATCTGGCCAGGACCCCAGGG + Intronic
951224555 3:20106052-20106074 CTGATCTGCCCTAGTTCACAGGG - Intronic
951416513 3:22429965-22429987 GTAATCTGCCCAGGATTCGATGG - Intergenic
951870620 3:27357589-27357611 GTGATGTGCCTAAGATGTCATGG + Intronic
951991722 3:28682824-28682846 ATGATCTGCCCTATATCCGAAGG - Intergenic
952124932 3:30289576-30289598 GTAATCTGCCCAAAAACACATGG - Intergenic
952470196 3:33639956-33639978 ATGATGTGCCCAAGATCACATGG - Intronic
953118277 3:40014435-40014457 GTTCTCATCCCAAGATCCCAGGG - Intronic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
954042177 3:47896995-47897017 GTGGTTTGCCCATGATCACATGG + Intronic
955259259 3:57368477-57368499 GTACTCTGCCCAAGGTCCCAAGG + Intronic
960737902 3:120800741-120800763 GTAATTTGCCCAAGATCACATGG + Intergenic
961042159 3:123685156-123685178 ATTATTTGCCCAAGTTCCCAAGG - Intronic
961379875 3:126490056-126490078 GTGACCTGCCCAAGGTCTCATGG - Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961637895 3:128344525-128344547 GTGACCTGCCCAAGGTCACAGGG + Intronic
961961056 3:130855559-130855581 GAGATTTGCCCAAGCTCGCATGG + Intronic
962032400 3:131614948-131614970 GTGAGCTTCCTAAGACCCCAGGG - Intronic
963371254 3:144403399-144403421 GAGACCTGCCCTAGATCTCAGGG + Intergenic
964519107 3:157543907-157543929 GTGACTTGCCCAAGATCATAAGG - Intronic
965251335 3:166348298-166348320 GTTATCTGCAGAAGATTCCAGGG + Intergenic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
966429269 3:179814415-179814437 CTGATTTGCCCCAGGTCCCATGG + Intronic
967101894 3:186222443-186222465 ATGATTTGCCCAAGGTCACATGG - Intronic
967662955 3:192135574-192135596 GTGATCTGACCAAGATTTCTTGG + Intergenic
969122339 4:4919580-4919602 GTGATGTGCAAAACATCCCAGGG + Intergenic
969210081 4:5680600-5680622 GTGATTTGCCCAGTATCCCATGG - Intronic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
970453717 4:16200037-16200059 GTGATTTGCCAGTGATCCCAAGG - Intronic
971361683 4:25943875-25943897 GGGACTTACCCAAGATCCCATGG - Intergenic
971612828 4:28747196-28747218 GTGCTATGTCCAAGATGCCAGGG - Intergenic
972456953 4:39264186-39264208 GTAATCTGCCCACGATCACATGG + Intronic
972763885 4:42133502-42133524 GTAACCTGCCCAGGATCACATGG - Intronic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
973809115 4:54552955-54552977 GTGGTTTGCCCAAGGTCGCATGG - Intergenic
975681909 4:76885748-76885770 GTGGTCTGCCTCATATCCCACGG + Intergenic
976221141 4:82757668-82757690 GTGATTTGACCAAGGTCACATGG - Intronic
976860770 4:89663449-89663471 CTGATCTGCCCAACATACCAAGG - Intergenic
977657285 4:99536628-99536650 GTGATGGGACCAAGTTCCCAGGG - Intronic
980895832 4:138859189-138859211 GTGATTTGCCCAAGATCAGACGG + Intergenic
981572018 4:146161834-146161856 GTAATTTGCTCAAGATCACATGG - Intergenic
983381077 4:166994362-166994384 GTAACCTGTCCAAGATCACATGG + Intronic
984544183 4:181079501-181079523 GTGATCTGTCCAAGATTACAGGG + Intergenic
984684498 4:182651001-182651023 GACATCTGCGCATGATCCCATGG + Intronic
985035726 4:185838340-185838362 GTGGCCTGCCCAAGCCCCCAGGG - Intronic
986265771 5:6189217-6189239 GTGACTTGCCCAAGATCCTAAGG + Intergenic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
987178838 5:15345398-15345420 GTGATTTGCCCAAGATGTTAGGG + Intergenic
988367114 5:30314527-30314549 GTGATCTGCCCTACATTTCAGGG + Intergenic
989710921 5:44396284-44396306 GTGAGCTGCCCAGGATGACAGGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
991287318 5:64992288-64992310 GTTATCTGCCCAAGATCCTATGG + Intronic
992210262 5:74472437-74472459 GTGATCTTCCCAACAGCCCCTGG + Intergenic
992249398 5:74862318-74862340 TTGATCTGGCCCAGGTCCCATGG - Intronic
993686401 5:90943361-90943383 GTGATCTGTCCAAGGTCATAAGG - Intronic
994997347 5:107080540-107080562 GTAATTTGCCCAAGATTACAAGG - Intergenic
995542394 5:113197777-113197799 GTAATCTGCTCAAGGTCACAGGG + Intronic
996164959 5:120212538-120212560 GTTATCTGCAGAAGATCTCAGGG + Intergenic
997846858 5:137294413-137294435 GTGATCTGCCCAAGGATGCAGGG + Intronic
998164206 5:139833269-139833291 GTGACATGCCCACGATCACAAGG - Intronic
998776565 5:145609993-145610015 CTGGTCTGCTCCAGATCCCAAGG + Intronic
999041360 5:148416744-148416766 GAGATCTGCCCAACAGCACATGG - Intronic
999055581 5:148572368-148572390 CTGATGTGCCCAAGGTCACATGG + Intronic
1000899643 5:166897013-166897035 GTGACCCGCCCAAGGTCACAAGG + Intergenic
1001217880 5:169872802-169872824 GTGATCTGCCCAAGATCCCAGGG - Intronic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1001768398 5:174273277-174273299 GTAATCAGCCCAAGACCTCATGG + Intergenic
1001955484 5:175845750-175845772 GTGATGTGCCCAAGGTCACGTGG + Intronic
1003467284 6:6392705-6392727 GTGACCTGCCCCTGTTCCCACGG - Intergenic
1003771891 6:9313897-9313919 GTAATCTGCTGAAGATCACAAGG + Intergenic
1003916681 6:10793351-10793373 GTAGCCTGCCCAAGATCTCACGG + Intronic
1003959857 6:11198848-11198870 CTGTTCTGCCCCATATCCCATGG - Intronic
1005398783 6:25410460-25410482 GTTACCTGCCCAAGATTGCATGG + Intronic
1006034781 6:31202693-31202715 GGCATCTGCCCCAGAACCCAAGG + Exonic
1006188574 6:32193978-32194000 GAGATCTGCCCAAGATTGCAAGG - Intronic
1006385889 6:33730731-33730753 ATAATCTGCCCAAGGTCACATGG + Intronic
1006744461 6:36331497-36331519 CTGAGCTGCCCAAAGTCCCAAGG - Intronic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1007965692 6:46001759-46001781 GTGTTTTGCTCAAGGTCCCATGG - Intronic
1008752223 6:54749404-54749426 GTAATATGCCCAAGGTCACAGGG - Intergenic
1011433901 6:87317032-87317054 GTGATTTGCACAAGATTCTATGG - Intronic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1012370143 6:98494821-98494843 ATAATTTGCCCAAGATCTCATGG - Intergenic
1013294386 6:108745871-108745893 GTGGTTTGGCCAACATCCCATGG - Intergenic
1014863987 6:126505790-126505812 GATAGCTGCCTAAGATCCCAGGG + Intergenic
1015095454 6:129409630-129409652 GTGATCTGCAGAAGATGGCAGGG + Intronic
1017112269 6:150943327-150943349 GTGATATTATCAAGATCCCAAGG + Intronic
1017214281 6:151892132-151892154 GTGATCTGCCCAAGGTTCCTAGG - Intronic
1019245997 6:170710100-170710122 GTCATCTTCCCAAGATGTCAGGG + Intergenic
1020708168 7:11571551-11571573 GTAACCTGTCCAAGATCACATGG + Intronic
1021496184 7:21276857-21276879 GAGACTTGCCCGAGATCCCAAGG + Intergenic
1022171454 7:27836028-27836050 GTGACTTGGCCAAGATCACATGG + Intronic
1022734043 7:33059676-33059698 GTAATTTGCCCAAGGTCACATGG + Intronic
1024650727 7:51401044-51401066 GTGATTTGCCCAAGCTCACCTGG - Intergenic
1025054848 7:55756630-55756652 GTGATTTGCCCAAGCTCACCTGG - Intergenic
1025097397 7:56106818-56106840 GAAATCTGCCCAAGGTCCCCTGG - Intergenic
1025132921 7:56386850-56386872 GTGATTTGCCCAAGCTCACCTGG - Intergenic
1025909561 7:65817493-65817515 GTGATTTGCCCAAGCTCACCTGG + Intergenic
1025911074 7:65829216-65829238 GTGATTTGCCCAAGCTCACCTGG + Intergenic
1025978636 7:66389634-66389656 GTGATTTGCCCAAGCTCACCTGG - Intronic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1026986687 7:74559354-74559376 GGGATTTGCCCAAGGTCCCGGGG + Intronic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1029136158 7:98373522-98373544 GTGATTTGCCCAAGAATTCAAGG - Intronic
1030188398 7:106786591-106786613 GTAATTTGCCCAGGATCCCACGG + Intergenic
1030924667 7:115437419-115437441 GTGAGTTGCCCAAGGTGCCATGG - Intergenic
1032853577 7:135815831-135815853 GTGACCTGCCCAAGACCCTAGGG + Intergenic
1033662888 7:143414870-143414892 GTGATTTGCCCAAGATCACTTGG - Intergenic
1034391559 7:150791512-150791534 GTGAGCTGCCAAAGACCCCACGG - Exonic
1034539144 7:151744996-151745018 GTGATTTGCCCAGGATCCGTGGG + Intronic
1034550887 7:151819960-151819982 GTGACGTGCCCAAGGTCACATGG + Intronic
1036492918 8:9244415-9244437 GTGATTTGCCCAAGATCACACGG - Intergenic
1037438281 8:18887983-18888005 GTGACTTGTCCAAGATCACACGG + Intronic
1037615866 8:20518586-20518608 GTAATGTGCCCAAGGTCACACGG - Intergenic
1037617164 8:20529866-20529888 GTGATTTGTCCAAGATCTCAAGG - Intergenic
1039417300 8:37406821-37406843 GTGATTTTCCCAAGGTCACATGG + Intergenic
1039820490 8:41130011-41130033 GAGATGTGACCAAGTTCCCAGGG + Intergenic
1040946963 8:52894204-52894226 TTGATGTGCCCAAGGTCACAAGG - Intergenic
1041263043 8:56038228-56038250 TGGATCTGCCCAAGAACCAAGGG - Intergenic
1042363469 8:67909056-67909078 GTGTTCTTCTCTAGATCCCAAGG - Intergenic
1045416624 8:101974030-101974052 ATTATCTTCACAAGATCCCAGGG + Intronic
1045664732 8:104471954-104471976 GTGATTTGCCCAAGATCACATGG + Intergenic
1046890706 8:119417777-119417799 GTGATGTCCCCAAGGTCCCCTGG - Intronic
1047367635 8:124226847-124226869 ATAATTTGCCCAAGATCACATGG - Intergenic
1047755088 8:127912397-127912419 GTAATCTGCCAAAGATCCCTTGG + Intergenic
1048009049 8:130442299-130442321 CTGACTTGCCCAAGATCACATGG - Intronic
1049239594 8:141530470-141530492 GTGACTTGCCCAGGGTCCCACGG + Intergenic
1049917206 9:329367-329389 GTGATCGCCCCATGATCTCATGG + Intronic
1049939915 9:535529-535551 GTGGTCTGCCCCAGGTCACAGGG + Intronic
1051038458 9:12776870-12776892 GTGACGTGCCCAAGAGCTCATGG - Intronic
1053281459 9:36822675-36822697 GTGATTAGCCAAACATCCCATGG + Intergenic
1053293083 9:36894926-36894948 GTCACCTGCCCAAGGTCACACGG - Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1055410329 9:76022022-76022044 TTGGTCTGCCCAAGAGCCTAGGG - Intronic
1056184566 9:84120950-84120972 GTAACCTGCCCAAGATCTCACGG - Intergenic
1056451122 9:86717678-86717700 GTAATGTGCCCAAGGTCACATGG - Intergenic
1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG + Intergenic
1057691781 9:97292340-97292362 GTGACCTTCCCAAGACCACATGG - Intergenic
1059368549 9:113806531-113806553 GTAATTTGCCCAAGGTCACAGGG + Intergenic
1059428761 9:114237466-114237488 GTGACTTGCCCAGGGTCCCATGG + Intronic
1060153493 9:121303230-121303252 GTGATTTGTCCAAGCTCACATGG - Intronic
1060214136 9:121728186-121728208 ATGAGTTGCCCAAGGTCCCAAGG - Intronic
1060451773 9:123749472-123749494 GTGACTTGCCCAAGATCTCAAGG - Intronic
1060880278 9:127113228-127113250 GTGATTTGCCCAGGAACACACGG + Intronic
1060903484 9:127282507-127282529 GTGATTTTCCCAAGGTCACATGG + Intronic
1060979567 9:127784823-127784845 GTCATTTGCCCAAGGTCACACGG - Intergenic
1061004243 9:127919406-127919428 GTGATTTGTCCAAGAACTCATGG - Intergenic
1061076683 9:128345585-128345607 GTGGTCTGTGTAAGATCCCATGG - Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061249411 9:129417674-129417696 GTGATCTGCCCAAGGTCACCTGG - Intergenic
1061480288 9:130894681-130894703 GTGACTTGCCCCAGATCTCATGG + Intergenic
1062559845 9:137136639-137136661 CTGATCTGCCCAAAATCCTAGGG + Intergenic
1186589776 X:10917650-10917672 CTGGTCTGCCCAACATGCCAGGG + Intergenic
1186592942 X:10950569-10950591 GTGATTTGTCCAAGGTCACACGG - Intergenic
1187185779 X:16983848-16983870 GTAATTTGACCAAGATCACATGG + Intronic
1191978329 X:66898209-66898231 GTGATCCAACCAAGATCACAGGG + Intergenic
1192844586 X:74892764-74892786 GCCATCTCCCTAAGATCCCAAGG + Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1193575106 X:83186355-83186377 GGGATCTTCCCAGGACCCCAAGG + Intergenic
1195075399 X:101322685-101322707 GTGATTTGCCCAAAATCATATGG - Intergenic
1196803033 X:119560598-119560620 GTGATTTGCCAAAGATCACCAGG - Intronic
1197332593 X:125172367-125172389 TTGACTTGCCCAAGGTCCCACGG + Intergenic
1197714050 X:129693529-129693551 GTGACCTGCCTAAGGTCACACGG - Intergenic
1197958366 X:131977474-131977496 TTGATTTGCTCAAGATCACATGG + Intergenic
1199088037 X:143651694-143651716 GTGATTTGCTCAAGGTCACATGG + Intergenic
1200248865 X:154541707-154541729 GGGATCTGCCCAAGGACACAAGG + Intronic