ID: 1001223742

View in Genome Browser
Species Human (GRCh38)
Location 5:169926170-169926192
Sequence TAGTCGGCATGGATGTGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001223736_1001223742 6 Left 1001223736 5:169926141-169926163 CCAAAGGGATCCAGGAGTAGGAG 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1001223742 5:169926170-169926192 TAGTCGGCATGGATGTGGATAGG No data
1001223733_1001223742 15 Left 1001223733 5:169926132-169926154 CCAGTCAGGCCAAAGGGATCCAG 0: 1
1: 0
2: 1
3: 9
4: 126
Right 1001223742 5:169926170-169926192 TAGTCGGCATGGATGTGGATAGG No data
1001223737_1001223742 -4 Left 1001223737 5:169926151-169926173 CCAGGAGTAGGAGTTCCTATAGT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1001223742 5:169926170-169926192 TAGTCGGCATGGATGTGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001223742 Original CRISPR TAGTCGGCATGGATGTGGAT AGG Intronic
No off target data available for this crispr