ID: 1001223811

View in Genome Browser
Species Human (GRCh38)
Location 5:169926734-169926756
Sequence CTGTAACTAGAGGTGAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001223808_1001223811 1 Left 1001223808 5:169926710-169926732 CCAATGCCTTTAAGGCTTGTGAC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1001223811 5:169926734-169926756 CTGTAACTAGAGGTGAAGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 155
1001223806_1001223811 29 Left 1001223806 5:169926682-169926704 CCTCAAAGATTATTTAAAGAAAA 0: 1
1: 0
2: 7
3: 131
4: 1419
Right 1001223811 5:169926734-169926756 CTGTAACTAGAGGTGAAGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 155
1001223809_1001223811 -5 Left 1001223809 5:169926716-169926738 CCTTTAAGGCTTGTGACTCTGTA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1001223811 5:169926734-169926756 CTGTAACTAGAGGTGAAGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001223811 Original CRISPR CTGTAACTAGAGGTGAAGTT TGG Intronic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
902239865 1:15081251-15081273 CTGTCACTGGACGTGGAGTTGGG - Intronic
904397501 1:30231902-30231924 ATGTCACTAAATGTGAAGTTTGG - Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
906925870 1:50115908-50115930 CTGTGATTGGAGATGAAGTTAGG + Intronic
906987273 1:50696847-50696869 CTGTAAGTAGATGTAAAGCTTGG + Intronic
908793613 1:67808866-67808888 CTGAATCTATAGGTCAAGTTAGG - Intronic
909320421 1:74279090-74279112 TTGTGACTAGAAGTGTAGTTTGG - Intronic
911477095 1:98387073-98387095 CTGTAGCTAGAGGCGAAGAAAGG + Intergenic
911518961 1:98905747-98905769 CAGTAACTAGAGATCAAATTAGG - Intronic
912971210 1:114285147-114285169 TTGGAACTAGAGGTGAAACTAGG + Intergenic
915695644 1:157739129-157739151 CTACAACTAGAGATGAAATTTGG + Intergenic
917708582 1:177660047-177660069 CTGGAATTAGAGGTAAAGTGGGG - Intergenic
919255380 1:195114665-195114687 CCATAACTACAGGTCAAGTTGGG - Intergenic
921597483 1:217070147-217070169 CTGTAAGTTGAGGTGATCTTAGG + Intronic
923843607 1:237702643-237702665 CTGTAATTACAGGTTAATTTTGG - Intronic
924181229 1:241440297-241440319 CTGGAACTAGAAGTGGAGTGTGG + Intergenic
1064618006 10:17182884-17182906 CTGTCATTATTGGTGAAGTTTGG - Intronic
1065407124 10:25381388-25381410 TAGTAACTAGAAGTGAATTTAGG + Intronic
1065664968 10:28049387-28049409 CTGTAACTTGAGGTAAAGCTGGG - Intergenic
1067345170 10:45433057-45433079 CTCTAACTACAGGTGAAGTTAGG - Intronic
1067759068 10:49029762-49029784 CTCCAACTAAAGGGGAAGTTGGG + Intronic
1068384524 10:56308078-56308100 CTGTAGCTAGCTGTGATGTTAGG + Intergenic
1068395842 10:56460321-56460343 CTGTAACTATAGGGGTAATTAGG + Intergenic
1071444539 10:85733406-85733428 CTGTAACTGGAGAAGAAGATGGG + Intronic
1074511513 10:114116816-114116838 CTGTAACTAGAAGTTAACTATGG + Intergenic
1074870644 10:117573318-117573340 ATGTCACTGGAGGTGGAGTTGGG + Intergenic
1079161453 11:17998637-17998659 CTGTAACTAGATTTGCAGATAGG + Intronic
1079664734 11:23090456-23090478 ATGTAATTACAGCTGAAGTTGGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085820072 11:79782997-79783019 TTGTAACCACAGGTGATGTTGGG + Intergenic
1086048815 11:82565021-82565043 CTATAAATAGAGCTGAAGTTTGG - Intergenic
1086856632 11:91873472-91873494 CCTAAACAAGAGGTGAAGTTAGG - Intergenic
1087569893 11:99912696-99912718 CTGTAACTAGAACTGTAGCTTGG - Intronic
1088350661 11:108883917-108883939 CTGGAAGTAGAAGAGAAGTTAGG - Intronic
1088879259 11:113960717-113960739 CTGAAACAAGAGGACAAGTTTGG + Intergenic
1090432772 11:126660263-126660285 CTGTCACTTGTGGTGCAGTTGGG + Intronic
1090548299 11:127790374-127790396 CTGTAAGAAGAGGTGAAGCCTGG + Intergenic
1091047479 11:132337300-132337322 ATGTGGCTAGAGGTGAGGTTTGG - Intergenic
1092961399 12:13599758-13599780 CTGTAAATAGATTTGAAATTTGG + Intronic
1094064017 12:26344037-26344059 CTGTAACAAAAGGGCAAGTTTGG + Intronic
1097585300 12:61508178-61508200 CTGTGACATGAGGTCAAGTTTGG + Intergenic
1098217218 12:68233476-68233498 CTGTGACTAGATTTGAAGATAGG + Intergenic
1098279882 12:68851781-68851803 CTGTAGCTAAAGTAGAAGTTTGG - Exonic
1099981175 12:89604896-89604918 CTGGAAGTAGGGGTGAAGGTAGG + Intronic
1101502521 12:105317291-105317313 TTGTAAGTGGTGGTGAAGTTAGG + Intronic
1103479485 12:121241781-121241803 CTGTAACTAGACGTTAGGTCAGG + Intronic
1105592949 13:21811405-21811427 GTGCAACTGGAGGTGAATTTGGG + Intergenic
1106150143 13:27092291-27092313 CTGAACCTATAGATGAAGTTGGG - Intronic
1107177874 13:37420840-37420862 TTGTAGGTATAGGTGAAGTTGGG + Intergenic
1107327692 13:39262867-39262889 TTATAACTAGAAGTGAAATTGGG + Intergenic
1111282663 13:86047470-86047492 CTGAAACTATAGGTTAACTTTGG + Intergenic
1113351610 13:109535036-109535058 CTGAAGCCAGAGGTGAAGGTGGG - Intergenic
1115123769 14:29969513-29969535 TAGTAACTAGAGGTGGAGATTGG + Intronic
1115208742 14:30942963-30942985 TAGTAACTAGTGGTTAAGTTAGG + Intronic
1117168267 14:53062387-53062409 ATGTAACTAGAGATGAAGATAGG + Intronic
1118203728 14:63702095-63702117 CAGAAGCTAGAGGTGAAGGTAGG + Intronic
1122569874 14:102689354-102689376 GTGGAACTAGAGGGGAAGCTCGG + Intronic
1125122833 15:36183111-36183133 CTGTAACCAGAGAGGAAGGTAGG + Intergenic
1127886003 15:63201488-63201510 ATGTGACAAGAGGTGAAGTTGGG + Intronic
1132229912 15:100173904-100173926 CTGTTTCTAGTGGTGATGTTTGG - Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134916060 16:18072074-18072096 CTGGAACTAGAGCTGATGTTGGG - Intergenic
1137264485 16:46857709-46857731 TTGCAACTAGAGGGGAAATTGGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1144546762 17:16203874-16203896 CTGAAATTGTAGGTGAAGTTTGG - Intronic
1144722318 17:17479955-17479977 CTGGAAATAGGGGTGAAGGTGGG + Intronic
1145299609 17:21623435-21623457 CTGAAATTGTAGGTGAAGTTTGG + Intergenic
1145350672 17:22079832-22079854 CTGAAATTGTAGGTGAAGTTTGG - Intergenic
1146422527 17:32701597-32701619 CTGTCACTTAAGCTGAAGTTCGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151576770 17:74956393-74956415 ATGTCACTAGAGGTGTATTTTGG + Intronic
1151597913 17:75089045-75089067 CTGGGACTAGGGGTGAGGTTGGG - Exonic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1157431822 18:47634516-47634538 CAGTAACTAGAGGGGACTTTGGG + Intergenic
1159234236 18:65650479-65650501 TTGAAACTAGAGGAAAAGTTTGG + Intergenic
1163290367 19:16375894-16375916 CTGTCAGTAGAGGTGAACATAGG - Intronic
1163574891 19:18104919-18104941 CTGTAACTGGAGATGACGTGAGG - Intronic
1165063127 19:33214566-33214588 CTGTAGCTAGAGGTGAGGTCAGG - Intronic
1166230752 19:41424827-41424849 CTGTAACAACAGGTGAAGAGGGG - Exonic
924966945 2:86184-86206 CTGTAACTTGAGGAAGAGTTGGG + Intergenic
927002173 2:18808953-18808975 CTGAAACTATAGATGAACTTAGG - Intergenic
929300561 2:40299498-40299520 CTGAAACTGGATGTGACGTTAGG + Intronic
929588217 2:43129263-43129285 CTCAAACTAGAGCTGAAGTCAGG + Intergenic
930461099 2:51677330-51677352 CTGTATAAAGAGGGGAAGTTTGG - Intergenic
930644870 2:53895167-53895189 CTCTAACTAGATGCTAAGTTTGG + Intronic
934101294 2:88655692-88655714 CTGAAACTAGGGGTGATCTTGGG + Intergenic
937787112 2:125914030-125914052 CTGAAATCAGAAGTGAAGTTGGG - Intergenic
938041215 2:128077811-128077833 CTGAAACAAGAGATGAAGATTGG - Intergenic
939442802 2:142271752-142271774 CTCTAACTAGAGGGAAAGCTGGG - Intergenic
941348419 2:164400411-164400433 CTGTAACTAGACCTAGAGTTAGG + Intergenic
942618338 2:177818738-177818760 ATAATACTAGAGGTGAAGTTTGG - Intronic
943972236 2:194425590-194425612 CTGTAACTTGAAATGAAGTCTGG + Intergenic
947560951 2:231151312-231151334 CTGTAACTAGATGTGAATAGAGG + Intronic
1169835999 20:9879917-9879939 CTGGAATTAGAGGTGAGGTGAGG + Intergenic
1170175303 20:13461986-13462008 CTGTAACTAGAGGGGATGATGGG + Intronic
1171560922 20:26124818-26124840 CTGAAATTGTAGGTGAAGTTTGG - Intergenic
1175417767 20:58812865-58812887 TTGTAATTAGAGGTGAATCTGGG - Intergenic
1175609786 20:60340904-60340926 CTGGACCTAGAGGAGAAGGTGGG - Intergenic
1175995523 20:62810582-62810604 CTGTGACTGGAGGGGAAGATGGG + Intronic
1176650295 21:9540251-9540273 CTGAAATTGGAGGTGAAGTTTGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1180645993 22:17339483-17339505 CTTAAACTAGAGGTGAGGTCCGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183065004 22:35356704-35356726 CTTTTACTGGACGTGAAGTTAGG + Intergenic
1184015083 22:41779957-41779979 CTGTAGCCACAGGTGAAGATGGG + Intronic
950513507 3:13448106-13448128 CTGAAACTATAGGTGAATTTGGG - Intergenic
952914279 3:38220995-38221017 ATCTACCAAGAGGTGAAGTTAGG + Intronic
953355980 3:42256720-42256742 CTTTCACTTGAGCTGAAGTTGGG - Intergenic
961908662 3:130290386-130290408 CTGAAACTATAGGTTAATTTGGG + Intergenic
963981116 3:151538092-151538114 CCTTAACTAAACGTGAAGTTTGG - Intergenic
964518487 3:157538895-157538917 CTGTGCCTAGAGGTGGAGTTTGG + Intergenic
965630459 3:170727311-170727333 CAGTAACTACAGGGAAAGTTGGG - Intronic
967474733 3:189903217-189903239 TTCTAAGTAGAGGTGGAGTTAGG - Intergenic
968311354 3:197686327-197686349 CTTTTACTAGAGGTAAAGTGAGG + Intronic
971094337 4:23382776-23382798 CAGTAAGTAGAAGTGAAGTTAGG - Intergenic
972192603 4:36612886-36612908 GGGTCCCTAGAGGTGAAGTTGGG + Intergenic
973181801 4:47277719-47277741 TTGTAATTAGATGTGAAGTTTGG - Intronic
973610968 4:52635739-52635761 GGGTAACTGGAGGTGATGTTTGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
978202081 4:106033853-106033875 CTGTAATTAGATGGGAACTTTGG - Intergenic
980968423 4:139546160-139546182 CTGTAACTAGAGGTACACTGTGG + Intronic
984245733 4:177273277-177273299 CTCTTACTAGCGGTGAAATTTGG + Intergenic
986601319 5:9475910-9475932 CTGTAAAATGAGTTGAAGTTTGG - Intronic
987160173 5:15133478-15133500 CTGTCATTAGAGCTGAAGCTAGG - Intergenic
990925611 5:61018220-61018242 ATGTCACTAAATGTGAAGTTAGG - Intronic
991268749 5:64754178-64754200 CTGTAACTAGATGTTAGCTTAGG + Intronic
991613978 5:68476974-68476996 CTGTAACTCCAGTTGAACTTTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
996446758 5:123562488-123562510 CTTTCATTAGATGTGAAGTTGGG + Intronic
998832127 5:146170981-146171003 TTGTAACTACAGGTGAAGGGTGG + Intronic
999778617 5:154830826-154830848 CGGTAGCGAGAGATGAAGTTAGG + Exonic
1001223811 5:169926734-169926756 CTGTAACTAGAGGTGAAGTTTGG + Intronic
1001261948 5:170237654-170237676 CTGGAAGTAGGGGTGAAATTTGG + Intronic
1004828704 6:19452835-19452857 CTGTAACTAGAAGAGAATATTGG + Intergenic
1006358542 6:33574670-33574692 TTGAAACTGGAGGTGAAGGTAGG - Intronic
1007646824 6:43389068-43389090 CTGGAACTGGAGGTGAAGTAGGG + Intergenic
1011253701 6:85399951-85399973 CTGTAGCTGCAGGTGAACTTAGG + Intergenic
1012000915 6:93653846-93653868 CTTTAACTAAAGGTGAATTGAGG - Intergenic
1013486935 6:110606308-110606330 CTGTAACTAGAGTTGAAGAAGGG - Intergenic
1015764490 6:136701388-136701410 CTTTAACTGGAAGTGAGGTTTGG - Intronic
1017542373 6:155415980-155416002 CTGGTGCTAGAGGTCAAGTTTGG - Intronic
1020717140 7:11688715-11688737 GAGTAACAAGAGGTGTAGTTAGG + Intronic
1024333777 7:48182824-48182846 CTGTAACTATAGTTGCTGTTTGG + Intronic
1025276912 7:57590543-57590565 CTGAAATTGTAGGTGAAGTTTGG + Intergenic
1027358760 7:77385912-77385934 CTGTAACAAAATGTGAAATTAGG + Intronic
1027370745 7:77506971-77506993 CTGAAACAAGAGGTGACCTTGGG + Intergenic
1027416551 7:77980489-77980511 CTGTAACTGGAAATCAAGTTAGG + Intergenic
1030803855 7:113889053-113889075 CTGTATATGGAGGTGAAGATGGG + Intronic
1034676167 7:152894344-152894366 CTGTGACTTGAGGTCAAGGTTGG + Intergenic
1035962138 8:4148931-4148953 GTTTAATTACAGGTGAAGTTAGG - Intronic
1038382740 8:27112311-27112333 CAGTAACAACAGGTGAAGTCAGG + Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1044093837 8:88037200-88037222 TTGGAACTAGCAGTGAAGTTTGG + Exonic
1044298110 8:90551972-90551994 CTACAACTAGAAGTGAATTTAGG - Intergenic
1046179403 8:110623939-110623961 ATGTGACTAGAGGTGTGGTTAGG - Intergenic
1050297879 9:4224647-4224669 ATGTAACAAAGGGTGAAGTTAGG - Intronic
1051094779 9:13454006-13454028 CTGCAACTAGAACTGAAGATTGG + Intergenic
1052301949 9:26962002-26962024 CTGTTTCAAGAGGTGGAGTTGGG + Exonic
1053087318 9:35236730-35236752 CTGAACCTTCAGGTGAAGTTAGG - Intronic
1055261605 9:74442304-74442326 CTGTGAGTAGAGGTGTATTTTGG + Intergenic
1056409765 9:86313381-86313403 CTGTAACTGGATGGGAAGCTAGG + Intronic
1059506527 9:114804289-114804311 CTGTCACTAGACGGGAAGCTCGG - Intronic
1059969912 9:119656050-119656072 ATGTAACTAAAGGGGATGTTTGG - Intergenic
1203628035 Un_KI270750v1:43805-43827 CTGAAATTGGAGGTGAAGTTTGG + Intergenic
1186149636 X:6660653-6660675 ATGTACCTAGAGCTGATGTTAGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186459371 X:9735964-9735986 CACTAAGTAGAGGTGAATTTGGG - Intronic
1186606025 X:11092833-11092855 GGGTATCTATAGGTGAAGTTTGG - Intergenic
1188396597 X:29692159-29692181 CTGCAACTATAGCTGATGTTTGG + Intronic
1188650130 X:32622142-32622164 CTGTAAGTGGAGGTGAAGTCAGG - Intronic
1193697789 X:84730164-84730186 GTGTACCTAGGTGTGAAGTTAGG + Intergenic
1194791313 X:98154132-98154154 CTGTCACAAGAGATGAAGATGGG - Intergenic