ID: 1001225051

View in Genome Browser
Species Human (GRCh38)
Location 5:169936994-169937016
Sequence TGGTAGCTTGAACACTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 143}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001225044_1001225051 9 Left 1001225044 5:169936962-169936984 CCACCACCTCTCCTGCCACTGCT 0: 1
1: 0
2: 16
3: 148
4: 1120
Right 1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
1001225047_1001225051 -2 Left 1001225047 5:169936973-169936995 CCTGCCACTGCTTTGCAAAAATG 0: 1
1: 0
2: 1
3: 16
4: 222
Right 1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
1001225049_1001225051 -6 Left 1001225049 5:169936977-169936999 CCACTGCTTTGCAAAAATGGTAG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
1001225041_1001225051 24 Left 1001225041 5:169936947-169936969 CCCAGACTGGGTTTCCCACCACC 0: 1
1: 0
2: 4
3: 23
4: 175
Right 1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
1001225046_1001225051 3 Left 1001225046 5:169936968-169936990 CCTCTCCTGCCACTGCTTTGCAA 0: 1
1: 0
2: 4
3: 54
4: 520
Right 1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
1001225042_1001225051 23 Left 1001225042 5:169936948-169936970 CCAGACTGGGTTTCCCACCACCT 0: 1
1: 0
2: 1
3: 24
4: 253
Right 1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
1001225045_1001225051 6 Left 1001225045 5:169936965-169936987 CCACCTCTCCTGCCACTGCTTTG 0: 1
1: 0
2: 7
3: 59
4: 617
Right 1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 143
1001225043_1001225051 10 Left 1001225043 5:169936961-169936983 CCCACCACCTCTCCTGCCACTGC 0: 1
1: 0
2: 5
3: 94
4: 753
Right 1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001225051 Original CRISPR TGGTAGCTTGAACACTGTGG AGG Intronic
908814162 1:68014415-68014437 TGGTTCCTAGAACACTGTGATGG + Intergenic
909736206 1:78966145-78966167 TGACAGCCTGTACACTGTGGTGG + Intronic
911039854 1:93582940-93582962 TGGCAGCTTGCAGCCTGTGGGGG + Exonic
911642447 1:100303553-100303575 TGGCAGGTTGACCACAGTGGAGG + Intergenic
915911685 1:159919404-159919426 TGGTATCTAGGACACTGCGGAGG - Intronic
916614842 1:166429232-166429254 TGGTGGCTTTTACACTGTGAGGG + Intergenic
918026146 1:180748809-180748831 TGGTAGCTTGAAATCTGCAGTGG + Intronic
918451351 1:184662183-184662205 TGGTAGCTTGAAATCTGTTATGG - Intergenic
918453824 1:184686764-184686786 TGTTAACTTGAACAGAGTGGAGG + Intergenic
1065989312 10:30992299-30992321 TAGAAGCTGGAAGACTGTGGAGG + Intronic
1069977621 10:72227202-72227224 TGATAGCTTTGAGACTGTGGAGG - Intronic
1072581120 10:96740999-96741021 TGGGAGCTTGAACAATTTGAGGG - Intergenic
1072903185 10:99427719-99427741 TGGTAGCCAGTACACTGTAGTGG - Intronic
1073130669 10:101187077-101187099 TGGTATCTGGAATAATGTGGGGG + Intergenic
1074737913 10:116454998-116455020 GGAAAACTTGAACACTGTGGAGG - Intronic
1079240017 11:18715489-18715511 TGGTGGCGAGTACACTGTGGTGG - Exonic
1079742696 11:24083357-24083379 TGGTAGCTTGAACCCAATGCTGG - Intergenic
1080972146 11:37290765-37290787 TGTTTGCTTGAACTATGTGGTGG + Intergenic
1081474592 11:43414321-43414343 TAGTATCTTGAGCAGTGTGGCGG + Intronic
1086456828 11:86967563-86967585 TTGGAGCTTGAATACTGTGCTGG + Intergenic
1086587324 11:88469444-88469466 TTGAACCTTGAACAATGTGGGGG + Intergenic
1088769929 11:113024038-113024060 AGGTACCTTGATCACTTTGGAGG + Intronic
1089392596 11:118112156-118112178 TTGTAGCTTGAACGATATGGGGG - Intronic
1089422177 11:118340119-118340141 TGGGACCTTGAACAAGGTGGTGG + Intronic
1091079265 11:132651203-132651225 TGGTGTGTTGAACACTCTGGTGG + Intronic
1093579057 12:20767222-20767244 TGGTATCTGGAATAATGTGGAGG - Intergenic
1094092139 12:26662207-26662229 TGGTAGTTTGAACATTTTTGGGG - Intronic
1097587826 12:61536019-61536041 TGGTAGCTTGAAATCAGTGATGG - Intergenic
1098175990 12:67792119-67792141 TTGGAGCTCGAACACTGTGCTGG + Intergenic
1102044180 12:109819439-109819461 TGGGAGCTTCCCCACTGTGGAGG - Intronic
1102227675 12:111240429-111240451 TGTTAGCTTGAGTGCTGTGGGGG - Intronic
1104362633 12:128148512-128148534 GGGTAGCTTGAAATCAGTGGTGG - Intergenic
1117922052 14:60735049-60735071 TGTTAGTTTCAACACTGGGGAGG + Intronic
1118498506 14:66333366-66333388 TCAGAGCTTGAACACTGTGCTGG - Intergenic
1121959438 14:98245340-98245362 TGGTTGCTTCCACACTATGGCGG + Intergenic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1125510542 15:40290311-40290333 TTGTAGCCTGTCCACTGTGGTGG - Intronic
1126691155 15:51289867-51289889 TGGTAGCATGAATGCTGTGTAGG - Intronic
1128782248 15:70368343-70368365 TCAGAGCTTGAACACTGTGCTGG - Intergenic
1129868145 15:78924372-78924394 TGGAAGCTGGAACAGTGTGTGGG + Intronic
1137771217 16:51016501-51016523 GGGTTGATTGAACACTGTGGGGG - Intergenic
1141359988 16:83386732-83386754 TGGTGGCTTAAACAGTTTGGGGG + Intronic
1145794483 17:27647504-27647526 AGGTACCTTGAACAGTATGGGGG + Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149093812 17:52816914-52816936 TCAGAGCTTGAACACTGTGCTGG + Intergenic
1149487122 17:57051346-57051368 GAATTGCTTGAACACTGTGGAGG - Intergenic
1153217835 18:2836706-2836728 TGGTAGTGTGAAGACTGTTGTGG - Intergenic
1155210783 18:23599263-23599285 CAGTAGCTTGAACAATATGGAGG - Exonic
1155665132 18:28299037-28299059 TCAGAGCTTGAACACTGTGCTGG + Intergenic
1155719989 18:29000040-29000062 CTGTAGCTTCAACACTGTGGAGG + Intergenic
1157991766 18:52504780-52504802 TGGTGGCTTTTACACTGAGGTGG - Intronic
1158880230 18:61771395-61771417 TGGTTGCCTGGGCACTGTGGTGG - Intergenic
1160129895 18:76215715-76215737 TGGTGGATGGAACAGTGTGGTGG - Intergenic
1163237867 19:16039779-16039801 TGGTGGCTTGGTCACTGGGGGGG - Intergenic
1164277881 19:23737779-23737801 GGCAAGCTTGAACAATGTGGAGG - Intergenic
1165283801 19:34820363-34820385 TGAAAGCTTGGACACAGTGGTGG + Intergenic
1165339635 19:35201847-35201869 TGGTAGCTTGAAATCAGTCGTGG - Intergenic
1166413011 19:42569312-42569334 TGGTAGCTCTAACACTCAGGGGG - Intergenic
1167024922 19:46908773-46908795 TGGAAGCATGAGAACTGTGGCGG + Intergenic
925135529 2:1523355-1523377 GGGGAGGTTGAACACAGTGGGGG - Intronic
925137529 2:1531396-1531418 GGGGAGGTTGAACACAGTGGGGG - Intronic
925138189 2:1534046-1534068 GGGGAGGTTGAACACAGTGGTGG - Intronic
925138888 2:1536846-1536868 GGGGAGGTTGAACACAGTGGCGG - Intronic
927050905 2:19327877-19327899 AGGTAGCTTGAAATCTGTGAAGG - Intergenic
927117221 2:19916855-19916877 TCAGAGCTTGAACACTGTGCTGG - Intronic
930216956 2:48707406-48707428 TCAGAGCTTGAACACTGTGCTGG + Intronic
930847317 2:55919786-55919808 TGGTACCTTTAACACTGTTTGGG - Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
935020430 2:99225096-99225118 TTGTAGCTTGGACATTGTGAAGG + Intronic
942960036 2:181819428-181819450 GGGTAGCTTGAACTCTGAGGAGG + Intergenic
944391995 2:199227525-199227547 TTGTAACTTGTTCACTGTGGTGG + Intergenic
947275799 2:228390745-228390767 TCAGAGCTTGAACACTGTGTTGG + Intergenic
947624879 2:231613206-231613228 TTGTTGCTGGAACACAGTGGGGG - Intergenic
948551430 2:238775470-238775492 TGGGACCTGGAACACTGGGGTGG + Intergenic
1170668395 20:18406702-18406724 TACCAGCTTGAACACAGTGGGGG + Intronic
1171247150 20:23620821-23620843 TCAGAGCTTGAACACTGTGCTGG + Intergenic
1171513342 20:25706215-25706237 TCAGAGCTTGAACACTGTGCTGG + Intergenic
1172758942 20:37308448-37308470 CGGCAGCTGGAACACAGTGGTGG - Intronic
1181675833 22:24451086-24451108 TGGTGGCCAGGACACTGTGGAGG - Intergenic
1182062018 22:27405164-27405186 TGGGAGCCTGCAAACTGTGGAGG - Intergenic
1182640376 22:31762186-31762208 TAGTACCTTGCACAATGTGGTGG - Intronic
1182898216 22:33875947-33875969 TGGCTGCTGGAAAACTGTGGAGG - Intronic
949683352 3:6541000-6541022 TCCGAGCTTGAACACTGTGCTGG + Intergenic
949771026 3:7578462-7578484 TGGTAGTGTGCACACTGAGGCGG - Exonic
950867214 3:16198868-16198890 TGGTAGCTGGATCTCTGGGGAGG - Intronic
951686168 3:25347030-25347052 GGGAAGCTTTAAAACTGTGGTGG + Intronic
953105983 3:39879418-39879440 TGGTATATTGAACATTGTGGAGG + Intronic
957811533 3:85228834-85228856 TCATATCTTGAACACTGTGCTGG + Intronic
958257409 3:91340910-91340932 TCAGAGCTTGAACACTGTGCTGG + Intergenic
958611907 3:96436820-96436842 TTGTGGCTTGCACCCTGTGGAGG + Intergenic
959788921 3:110333425-110333447 TGGGAGCTGGAACAGTTTGGAGG - Intergenic
962463754 3:135638244-135638266 TGGGAGGAAGAACACTGTGGAGG - Intergenic
962959916 3:140301228-140301250 TGATAGCTATAACACTGTGATGG - Intronic
966423252 3:179754923-179754945 TGGTAGCAGCAACACAGTGGTGG - Intronic
967567394 3:190988433-190988455 TGGCAGCTTCCACACTGTGTTGG + Intergenic
968752068 4:2395484-2395506 TGGGAGCTGGAACAGTGTGAGGG + Intronic
971483578 4:27137026-27137048 TGGTAGCTTGAACATTTTATAGG + Intergenic
974772224 4:66431353-66431375 TGGTTGCTTGAACATTATTGAGG + Intergenic
978147918 4:105398653-105398675 TGGTAGAATGAACACTTAGGAGG + Intronic
979487539 4:121285423-121285445 TTGGAGCTTGAACTCTGTGCTGG - Intergenic
980137042 4:128868017-128868039 TGTAAGCTTTAACACTGTTGAGG + Intronic
980558694 4:134442636-134442658 TCGGAGCTTGAACGCTGTGCTGG + Intergenic
980770341 4:137363895-137363917 TAGTAGATTGAACACTGCTGAGG + Intergenic
984438317 4:179733086-179733108 TTGGTGCTTGAACAGTGTGGGGG + Intergenic
986316451 5:6591915-6591937 TGGTAGCTGGGACACTCTTGGGG + Intergenic
987157582 5:15106084-15106106 TGGCAGATTGGATACTGTGGTGG + Intergenic
989560258 5:42842251-42842273 TGCCAGCTAGAACCCTGTGGAGG + Intronic
991247545 5:64524193-64524215 TGATAGAATGAACACTGTGCTGG - Intronic
992224208 5:74603621-74603643 GGGGAACTTGTACACTGTGGTGG + Intergenic
992485963 5:77195539-77195561 TTGACCCTTGAACACTGTGGGGG + Intergenic
994706664 5:103215274-103215296 TGGTAGCTTCAAAATTTTGGTGG + Intergenic
995695798 5:114876847-114876869 TCAGAGCTTGAACACTGTGCTGG - Intergenic
996922763 5:128788297-128788319 TTGTACCCTGAACAATGTGGAGG + Intronic
999190161 5:149741360-149741382 TGGTACCCAGAACACTGGGGAGG + Intronic
1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG + Intronic
1001792108 5:174466555-174466577 TTGGAGCTTGAACACCGTGCTGG - Intergenic
1003434366 6:6072211-6072233 TCAGAGCTTGAACACTGTGCTGG + Intergenic
1006369726 6:33636422-33636444 TGGGAGCCTGGACAATGTGGTGG + Intronic
1006529280 6:34636682-34636704 TGGTATCTTAAACAGTGTAGAGG - Intronic
1009861097 6:69333349-69333371 AGGTAGATTGAACACAGTGTTGG + Intronic
1011793540 6:90926856-90926878 TGGTATCTTGAAGAGTGTGTAGG + Intergenic
1012778063 6:103522523-103522545 TCAGAGCTTGAACACTGTGCTGG - Intergenic
1013108141 6:107043384-107043406 TTGATGCTTGAACAGTGTGGGGG + Intronic
1013591270 6:111621135-111621157 TGGTAGCTTGAAATCAGTGATGG + Intergenic
1016563181 6:145420185-145420207 TATTGGCTTGAATACTGTGGTGG - Intergenic
1020333468 7:7042763-7042785 TCAGAGCTTGAACACTGTGCTGG - Intergenic
1021782254 7:24117838-24117860 TCAGAGCTTGAACACTGTGCTGG + Intergenic
1023291107 7:38669997-38670019 TGGAAGCTTGGGAACTGTGGAGG + Intergenic
1023296742 7:38722834-38722856 TAGAACCTTGAACAATGTGGGGG + Intergenic
1024372859 7:48606726-48606748 TCGGAGCTCGAACACTGTGCTGG + Intronic
1033147558 7:138884172-138884194 TGGAAGGCTGAACACTGTGGAGG + Intronic
1033273073 7:139950374-139950396 GGGGTGTTTGAACACTGTGGGGG - Intronic
1039788929 8:40858711-40858733 TAGTACCTTGAAGACTGAGGTGG - Intronic
1039814734 8:41083215-41083237 TGTTAGCTTAACCACTGTGCAGG + Intergenic
1041944376 8:63424815-63424837 TCAGAGCTTGAACACTGTGCTGG - Intergenic
1048446261 8:134495640-134495662 TGGTACCTGGCACAGTGTGGTGG + Intronic
1051357826 9:16255573-16255595 TGGTGGCTTGGACAGGGTGGTGG - Intronic
1052785921 9:32828307-32828329 TGGTTCTCTGAACACTGTGGTGG - Intergenic
1057561226 9:96129479-96129501 TGTTAGCTTTAAAATTGTGGTGG + Intergenic
1058320400 9:103622913-103622935 TTGTCCCTTGAACAATGTGGGGG - Intergenic
1062179120 9:135181225-135181247 TGGTACTTTGAACATGGTGGGGG + Intergenic
1187480329 X:19649154-19649176 GGGGAGCAAGAACACTGTGGAGG - Intronic
1187981599 X:24763190-24763212 TGGTAGCTTGACTAGTGTGATGG + Intronic
1189978417 X:46485859-46485881 TCGGAGCTTGAACGCTGTGCTGG + Intronic
1191784870 X:64906444-64906466 TGCTAGCTTGAACACTGGGTAGG + Intergenic
1191894048 X:65974459-65974481 TGGTTGGTGAAACACTGTGGTGG + Intergenic
1191947744 X:66554012-66554034 TCTTAGCTTGGACTCTGTGGAGG - Intergenic
1195331077 X:103801189-103801211 GGGGTGCTGGAACACTGTGGAGG - Intergenic
1195414283 X:104602955-104602977 TCAGAGCTTGAACACTGTGCTGG - Intronic
1201670585 Y:16515934-16515956 TCAGAGCTTGAACACTGTGCTGG + Intergenic