ID: 1001226300

View in Genome Browser
Species Human (GRCh38)
Location 5:169947324-169947346
Sequence TTTTCCAAGGGGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001226290_1001226300 21 Left 1001226290 5:169947280-169947302 CCAAGATTGTGAAGAGGAGATGG 0: 1
1: 0
2: 0
3: 15
4: 205
Right 1001226300 5:169947324-169947346 TTTTCCAAGGGGAATGAGGAGGG 0: 1
1: 0
2: 3
3: 32
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001226300 Original CRISPR TTTTCCAAGGGGAATGAGGA GGG Intronic
901819909 1:11822049-11822071 TTCTCCCAGGGGAGAGAGGAAGG + Intronic
903116298 1:21181225-21181247 TTGGCTAAGGGGAGTGAGGACGG - Intergenic
903870357 1:26429665-26429687 TTTTCCCAGGGAAAGGAGAAGGG - Exonic
904087196 1:27917146-27917168 TTTTTAAAGAGGAAGGAGGAAGG - Intergenic
905371900 1:37486835-37486857 TTTTCCAGGAGGCATGGGGAAGG - Intergenic
905527765 1:38652122-38652144 TTTTTCAAGGGTAGTGAGTAGGG + Intergenic
906280517 1:44550184-44550206 TTTGCCAAGGGGACTGTGGAGGG - Intronic
910629465 1:89340693-89340715 TTTCCCAGGGGCCATGAGGATGG - Intergenic
915305932 1:154978389-154978411 TTTTCGATGGAGAATGAGGCAGG - Intronic
915836757 1:159183002-159183024 TTTTCCAGGCTGAATGAGGAGGG - Intronic
917150564 1:171939603-171939625 TTTCTAAATGGGAATGAGGAAGG - Intronic
917330770 1:173878409-173878431 TTTTCCCAGGGAAAGGAGAAGGG + Intronic
918913734 1:190607936-190607958 TGATCCAAGGGGAATGGGGGTGG + Intergenic
919974161 1:202600047-202600069 TTCTCCCAGGGAAATGAGCAGGG - Intronic
920495239 1:206450030-206450052 TTTTCAAAGGGGAAGCAGGGTGG - Intronic
921027125 1:211295313-211295335 TTTTCCAATAGTAATGATGATGG - Intronic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
921544573 1:216459297-216459319 TTTTCCAAAGAAAAGGAGGAAGG - Intergenic
921726598 1:218531233-218531255 TTTTCCAAGAGGAAAAAGTAAGG - Intergenic
923265818 1:232313084-232313106 ATTTCCCAGGGAAATGAGTAGGG + Intergenic
923696374 1:236256114-236256136 TTTTCCAAGGAGAGAGTGGATGG - Intronic
1063125103 10:3130069-3130091 CTTTCCAAGGGGCATGGAGATGG + Intronic
1063589450 10:7381840-7381862 TTTTCCAAGGGTGAAGATGAAGG + Exonic
1065960769 10:30732439-30732461 CATTCCAGTGGGAATGAGGAAGG - Intergenic
1068430992 10:56931960-56931982 TTGTACAAGGGGAAGGATGAGGG + Intergenic
1069100340 10:64312388-64312410 ATTTACAAAGGGTATGAGGACGG + Intergenic
1070646398 10:78205048-78205070 CTTTCCTAGGGGAAGGAGGAAGG - Intergenic
1070760084 10:79018688-79018710 CCTTCCAAGGGGAATGGGGTGGG + Intergenic
1073048911 10:100655568-100655590 TTTTCCACTGGGAATTGGGAAGG - Intergenic
1073195439 10:101687182-101687204 TTTTGTAGGGGGGATGAGGATGG - Intronic
1074204510 10:111271235-111271257 TTTTCCTAGGGAAATGTGGGAGG + Intergenic
1074339934 10:112618599-112618621 TTGGCCTAGGGGAAGGAGGAAGG + Intronic
1076088128 10:127653785-127653807 GTTTGAAATGGGAATGAGGATGG - Intergenic
1079401943 11:20112833-20112855 CTTTCCAAGGGGAAGGAGCTGGG - Intronic
1079758693 11:24300677-24300699 TTTTCCAATGTAAAGGAGGAGGG + Intergenic
1079891829 11:26065443-26065465 TTTTCCTAGGGGAGTGCTGATGG + Intergenic
1079908380 11:26278251-26278273 CTTTCCAAGGAAAATGAGCAAGG - Intergenic
1079956856 11:26876876-26876898 TTTTCCAAGGTTAATGTGAAAGG + Intergenic
1080250670 11:30229534-30229556 TTTCCAAAGGAGACTGAGGAGGG - Intergenic
1080941598 11:36924439-36924461 ATTAACAAGAGGAATGAGGAAGG + Intergenic
1081942360 11:46954849-46954871 TTTTCCCAGGGAAAGGAGAAGGG + Intronic
1084667967 11:70586715-70586737 TTATCCTAGGGGAATGGCGAGGG + Intronic
1084902142 11:72317652-72317674 TTTTTCAAGAGGAAAGAGAAAGG - Intronic
1086260182 11:84930552-84930574 TCTACTAAGTGGAATGAGGATGG - Intronic
1086874663 11:92081141-92081163 TTTTCCAAGGGAAATGAACATGG + Intergenic
1088437134 11:109826821-109826843 TTTGCCTAGAGTAATGAGGAAGG + Intergenic
1088474203 11:110218497-110218519 TTTCCCAAGGGGAAAGTGTAAGG - Intronic
1088892362 11:114055229-114055251 TTTTCAAAAGGGTAGGAGGAGGG - Intergenic
1089902873 11:122006538-122006560 TTTGCCAATGGGTATGAGGTGGG - Intergenic
1090091269 11:123700603-123700625 GTTTTCAAGGGGAATGAGGGAGG + Intergenic
1090974504 11:131670225-131670247 TTTGCCAAAGGGGATGAGGGTGG - Intronic
1091446921 12:549096-549118 TTTTCAACGGGGCCTGAGGATGG - Intronic
1091522437 12:1259905-1259927 TTATCCAAGGGCAATTAGTAAGG - Intronic
1092034005 12:5315006-5315028 TTTAAAAAGGGGAAAGAGGAAGG - Intergenic
1092942758 12:13425861-13425883 TTTGCCACGGGGAATGCGGGAGG - Intergenic
1093582868 12:20804270-20804292 TTTACACAGGGGAATGAGGTTGG + Intergenic
1093969456 12:25361648-25361670 TCTTCCACTGGGAATGAGAAGGG + Intergenic
1094381378 12:29847212-29847234 TTTTCCCAGGGAAAGGAGGTGGG - Intergenic
1094424713 12:30305892-30305914 TATCCCTAGGGAAATGAGGAGGG - Intergenic
1095759596 12:45814666-45814688 TTTTATAACTGGAATGAGGAGGG - Intronic
1095960339 12:47830499-47830521 TTTTGGAAGAGGAAAGAGGAAGG - Intronic
1096298797 12:50407495-50407517 TTTTAAAAGAGGAATGAAGATGG + Intronic
1097933201 12:65213792-65213814 TTTTGAAAGGGGAGTGAGGAAGG + Intronic
1098082100 12:66798046-66798068 TCTTCCAAGGGGAATGAAAAAGG + Intronic
1098233271 12:68394662-68394684 TTTCCCAAAGGGAATAATGAAGG + Intergenic
1098479746 12:70944328-70944350 ATATCCAAGGGGAGAGAGGATGG - Intergenic
1099182447 12:79483936-79483958 TTGTCCAGGGGGTAAGAGGAAGG - Intergenic
1099839093 12:87943581-87943603 TTTTCTAAGGTGAATAAGGTTGG - Intergenic
1100897550 12:99201072-99201094 TGTTCAAAGGGCAATAAGGAGGG + Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1102867163 12:116383476-116383498 TTCTCCCAGGGGAAAGAGAAAGG - Intergenic
1103510971 12:121473924-121473946 TACTCCAAGGGGAATGAGCCTGG + Intronic
1104190848 12:126480571-126480593 ATTTCCAAGGAAAAAGAGGAGGG - Intergenic
1104345000 12:127987979-127988001 TATACCAAGTGGAATGAGGCCGG - Intergenic
1108085960 13:46794140-46794162 TTTTTGGAGGGGAAGGAGGAAGG - Intronic
1108211750 13:48146345-48146367 GTTGCCAAGGGGAGTGAAGAGGG - Intergenic
1109811857 13:67523487-67523509 TTTTCCAAAGGGAATGAAAATGG - Intergenic
1112200836 13:97272949-97272971 TCTTCCAGGGGGAATGAAAAAGG + Intronic
1113309890 13:109121273-109121295 TCTTCCAGGGTTAATGAGGAGGG + Intronic
1113447097 13:110377552-110377574 CTTTCCATGGGGAATCAGGAGGG + Intronic
1114076398 14:19163558-19163580 TTTACCATGGGGGAGGAGGAGGG + Intergenic
1114085771 14:19236011-19236033 TTTACCATGGGGGAGGAGGAGGG - Intergenic
1114447289 14:22798740-22798762 TTTTGCAGGGTGAAAGAGGAAGG - Intronic
1114893584 14:26957459-26957481 TTTACCAAGGGGAAGGTGGTGGG + Intergenic
1115344916 14:32332318-32332340 TTTTCCAATTAGAATGAGGAGGG - Intronic
1116518078 14:45822899-45822921 ATTTCCAGGGGTAAAGAGGATGG + Intergenic
1117648931 14:57882176-57882198 TTCTCCAGGGGGAAGGGGGATGG - Intronic
1117720837 14:58627389-58627411 TATTCCAAAGGGAAGGAGGGTGG + Intergenic
1118076933 14:62309544-62309566 TTTGCTAAGGGGAAGGAGGGGGG + Intergenic
1119988595 14:79169099-79169121 TTTTCAAGGGTGACTGAGGATGG - Intronic
1120108348 14:80522543-80522565 TCTTTCAAGGGGAAGAAGGATGG + Intronic
1120430907 14:84413443-84413465 TTTTCGAAGTGGAATGAGCCAGG - Intergenic
1120440494 14:84531142-84531164 TTTACCAAAGAGAATGAGAATGG - Intergenic
1121059685 14:90895208-90895230 TTTTAAAAGGGTAATGAGGCTGG + Intronic
1122448826 14:101787350-101787372 TTTGCCAGGTGGAAGGAGGAAGG + Intronic
1202897323 14_GL000194v1_random:17724-17746 TTTACCATGGGGGAGGAGGAGGG - Intergenic
1124435218 15:29642982-29643004 TTTTGCATGTGGAATGAGGTAGG - Intergenic
1124550933 15:30680735-30680757 ATCTCCAAGAGGAATGTGGATGG - Intronic
1124680320 15:31724934-31724956 ATCTCCAAGAGGAATGTGGATGG + Intronic
1127214303 15:56808477-56808499 TTTTCCATGGAAAATGAAGATGG - Intronic
1127233622 15:57023404-57023426 TTTTTCAAGCAGAATGGGGAGGG - Intronic
1127694841 15:61435016-61435038 TTTTCCAAGATGATTGAGCAGGG - Intergenic
1128526378 15:68415008-68415030 TTTTGCAAGAGTAAAGAGGAGGG - Intronic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1129534629 15:76302537-76302559 TTTTCCAGGGGGAGTGGGGGCGG + Intronic
1130904230 15:88228573-88228595 TCTGCCCAGGGGAATCAGGAAGG - Intronic
1131352730 15:91716444-91716466 TTTCCAAAGGGGAAAGAGAAAGG - Intergenic
1132124520 15:99210972-99210994 TTTTCCAAAAGGAAAGGGGATGG - Intronic
1133605575 16:7384574-7384596 TTTCCCATGGGGAAATAGGAGGG + Intronic
1135749288 16:25044141-25044163 TTTTACAAGGAGAATGAGAAAGG + Intergenic
1135757496 16:25110041-25110063 TTTGCCAGGGGGAATGCTGATGG - Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1138465376 16:57186279-57186301 GTTTCCTAGGGGACTGAGGGAGG + Intronic
1139282952 16:65785481-65785503 CTTTCCATGGGGCCTGAGGAAGG + Intergenic
1139803602 16:69544609-69544631 GTTTCTAAGGGGAAGGAGAAAGG + Intergenic
1140102491 16:71930070-71930092 TTTTCCAAAGGCCATGAGAATGG + Exonic
1140332600 16:74072412-74072434 TTTCCAAAGGGAAATGAGAAGGG + Intergenic
1140949088 16:79798496-79798518 TTTTTCCAGGGCAATGAAGAAGG - Intergenic
1141753936 16:85978832-85978854 TTTTCCAAGGGCAAGGAGAAAGG - Intergenic
1141755595 16:85988673-85988695 ACTTCCAGGGGGCATGAGGAGGG + Intergenic
1142251725 16:88994969-88994991 TTCTCCAAGGGGAAGGGGAAGGG - Intergenic
1143005201 17:3827398-3827420 TTTTCCAATGGGAATGATGAAGG - Intronic
1143110174 17:4548560-4548582 TTTTCCAAAGGGAAGGAGAACGG + Exonic
1143181271 17:4985980-4986002 TTTTCTAAAGGGAATTAGAAGGG + Exonic
1143305123 17:5940488-5940510 TTGTCAAAGGGGAGAGAGGATGG + Intronic
1144247972 17:13386556-13386578 TTTAGGAAGGGGAAAGAGGAGGG - Intergenic
1145028534 17:19487282-19487304 TTTTCCAAAGGGGATCTGGATGG + Intergenic
1146785493 17:35717236-35717258 ATTGCCAAGAGGAATGTGGAAGG + Exonic
1148245917 17:46030778-46030800 GGTACCAAGGGGCATGAGGAGGG + Exonic
1148388321 17:47252713-47252735 TTTTCCAAGTGGAAAAAGGAAGG + Intergenic
1149891949 17:60397875-60397897 TTTTACAGTGGGAGTGAGGATGG + Intronic
1151042734 17:70882640-70882662 TCTTCCAAGAGGGAGGAGGAGGG + Intergenic
1151262041 17:72923756-72923778 TTTTCCAATAGGATTGAGGCGGG + Intronic
1153736581 18:8076171-8076193 TCTTCCAAAAGAAATGAGGAAGG - Intronic
1155720192 18:29001726-29001748 ATTTCCAAGAGGACTGAAGATGG - Intergenic
1156091718 18:33479537-33479559 TCTTCCAGAGGGAATGTGGAAGG - Intergenic
1156125356 18:33898448-33898470 TTTTTCAAGGGCTATGTGGAAGG - Intronic
1156856147 18:41783390-41783412 ATTTCCAAAGGGTGTGAGGAAGG - Intergenic
1157827926 18:50829641-50829663 TTTTCCAAGGGGTAGAAGAATGG - Intergenic
1157899242 18:51498098-51498120 TTCTCCAAGGGGAAGGGAGAAGG + Intergenic
1158809726 18:61018524-61018546 TTTTCCATGCTGGATGAGGAAGG - Intergenic
1158899543 18:61949939-61949961 TTTCCGAAGGGGAATGGTGAGGG - Intergenic
1158981595 18:62767208-62767230 TTTTCCAACAGGAATGGGGAAGG + Intronic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1159485324 18:69048725-69048747 TCTTCCAAGGGGTATGGGGGAGG - Intronic
1159590979 18:70334652-70334674 TTCTCAAAGGTGAATGAGTAAGG + Intergenic
1159904071 18:74074950-74074972 TGTTGCAAGGGGAGTGAGGGAGG - Intronic
1161389536 19:4014017-4014039 CTTTCCAAGGGGAATAAGCAGGG - Intronic
1162911239 19:13848926-13848948 TTTTCCAAGTGGAAGGTAGAGGG - Intergenic
1167266590 19:48485777-48485799 TTCTCCACGGGGCCTGAGGATGG + Exonic
1167766814 19:51488779-51488801 TGCTCTTAGGGGAATGAGGAGGG - Intronic
1168126733 19:54288122-54288144 TTTTCCCAGGAAAATGAGAATGG + Intergenic
1168247535 19:55120470-55120492 TTTTCCTGGGGGAAGGAGGTTGG - Intergenic
925545223 2:5008765-5008787 CTTTCCACTGGGAATGAGGTAGG + Intergenic
925840019 2:7982662-7982684 TTTTCCCAGGGAAAGGAGAAGGG - Intergenic
925972051 2:9112785-9112807 TTATCCCAGGAGAGTGAGGAGGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
929494911 2:42432267-42432289 TTTTCCTAGGGCAATGCTGAAGG + Intergenic
930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG + Intronic
932470311 2:71950847-71950869 TTTCCCAAGGCCAGTGAGGAAGG - Intergenic
935024664 2:99264762-99264784 TTTTCCACTGGGACTGGGGATGG - Intronic
935891536 2:107684200-107684222 TTATCCAAAGAGAATGTGGAAGG + Intergenic
937072553 2:119075041-119075063 TTGTCCAAAGGAAATGAGGAAGG + Intergenic
937556328 2:123162301-123162323 TTTTCCAATAGTAATGATGATGG - Intergenic
938618354 2:133022672-133022694 TCTTCCGAGGGGATAGAGGAGGG - Intronic
940356546 2:152749675-152749697 TCTTACAAGGGGTATGAAGATGG - Intronic
942523136 2:176825656-176825678 TCTTGCATGGGGAAGGAGGAAGG - Intergenic
942801204 2:179878364-179878386 TTTTCCTAGAGTAAAGAGGATGG - Intergenic
944051410 2:195474339-195474361 TCTTCCAAAGGGAAAGAGGGAGG + Intergenic
945450675 2:209991820-209991842 TTTTCCAAGGGGAAGGGAAACGG - Intronic
945511045 2:210703079-210703101 TTTTTCTAAGGGAATGAGTAAGG + Intergenic
945629254 2:212251986-212252008 TTTTACAAGGGTAATGACAATGG + Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946131345 2:217609446-217609468 GAATCCAAGGGGAAGGAGGAAGG + Intronic
946348930 2:219135202-219135224 TTCTACTAGGGGAAAGAGGAGGG + Intronic
946371569 2:219284730-219284752 CTGTCCAAGGGGCATGAGGCAGG - Exonic
946399097 2:219459507-219459529 CTCTCCAAGGGGCTTGAGGATGG + Intronic
946525750 2:220518153-220518175 TGTTCTAAGGGGAAGGAAGATGG - Intergenic
948782148 2:240328489-240328511 GATTCCAAGGGGGATGAGGAGGG - Intergenic
1169519386 20:6354790-6354812 TTTTCCATGGAACATGAGGATGG + Intergenic
1169999968 20:11605004-11605026 TTTTCCCAGGGAAAGGAGAAGGG + Intergenic
1171352410 20:24513321-24513343 TTCTCCAAGCTAAATGAGGAAGG + Intronic
1172309333 20:33905509-33905531 TTTTCCATGGGTGATGAGGCTGG - Intergenic
1174531407 20:51217496-51217518 TTCTACTAGGGCAATGAGGAAGG - Intergenic
1175134627 20:56813805-56813827 TGTTGCAGGGGGAATGAGGGAGG - Intergenic
1175713499 20:61239877-61239899 TTTTCCATGTGTAATGAGGTAGG + Intergenic
1175765063 20:61586752-61586774 TTTTCCAAGGGCAAACAGGATGG - Intronic
1176617008 21:9033713-9033735 TTTACCATGGGGGAGGAGGAGGG - Intergenic
1178332351 21:31709292-31709314 TTTTCCCAGGGGAAGGAGAAGGG - Intronic
1179595020 21:42437631-42437653 TTCTCCAAGGGGAGTGGGAAGGG + Intronic
1179597018 21:42449740-42449762 TTTTGCAAGGAGAATGAGATGGG + Intergenic
1180098266 21:45571629-45571651 TTTTCTAACTGGAGTGAGGAGGG - Intergenic
1180292203 22:10857182-10857204 TTTACCATGGGGGAGGAGGAGGG + Intergenic
1180495008 22:15886604-15886626 TTTACCATGGGGGAGGAGGAGGG + Intergenic
1180867275 22:19126840-19126862 TTCTCCAAGGGGACTGAGGTTGG - Intergenic
1183448272 22:37874732-37874754 TTTTCAAAATGGAATGATGATGG + Intronic
1184507009 22:44909988-44910010 TTTTCCAAGGGCAAGGACCATGG + Intronic
1185147297 22:49146111-49146133 TTTTCCATGGGGATTGACTAAGG - Intergenic
1185379735 22:50502909-50502931 TTTCCCAGGAGGCATGAGGATGG - Intergenic
949388637 3:3534921-3534943 TTATTTAAGGAGAATGAGGAAGG - Intergenic
949922698 3:9015297-9015319 TGTTCCAGGAGGAATGAGCACGG - Intronic
951705720 3:25542418-25542440 TTTTCCAAAGGAAATTAGGGTGG + Intronic
952717039 3:36490263-36490285 CTTTCTCAGGGGAGTGAGGAGGG + Intronic
952925385 3:38316150-38316172 TCCTTCAAGGGGGATGAGGAGGG - Intronic
953309464 3:41863181-41863203 TTTGGAAAGGGGAAGGAGGAAGG - Intronic
955041235 3:55319692-55319714 TTTCCCAAGGGGATTGAGTGAGG - Intergenic
956621369 3:71224308-71224330 TCTTCCTAAGGGAATGAGTATGG - Intronic
956806034 3:72812449-72812471 TTTTCCGAGAGGAGTAAGGAAGG - Intronic
957287928 3:78241028-78241050 GTTTTTAAGGGGAATGATGATGG - Intergenic
957731422 3:84142744-84142766 TTTTCCAAAGTGAAATAGGAAGG + Intergenic
957999362 3:87731909-87731931 TTTTGAAATGGAAATGAGGAGGG + Intergenic
958608135 3:96386937-96386959 TTTTGTAAGTGGCATGAGGAAGG + Intergenic
959961045 3:112298374-112298396 GTTTACTAGGGGATTGAGGATGG - Intergenic
960965020 3:123098615-123098637 TCTTCCATGGAGAATGTGGAAGG - Intronic
961237518 3:125380077-125380099 TTTTCCATGGGGAATAAAAAGGG + Intergenic
962107944 3:132413046-132413068 TTTTCAAAGATGGATGAGGAGGG - Intergenic
963269872 3:143275891-143275913 TTTTCCTAAGAGAATGAGGCAGG + Intronic
964388285 3:156172592-156172614 TTTAAAAAAGGGAATGAGGATGG + Intronic
964795023 3:160487681-160487703 TGTTCCAAGTGGTGTGAGGAAGG + Intergenic
965966002 3:174490382-174490404 ATTTCCTAGGGGAAGGAGAAAGG + Intronic
967899495 3:194434994-194435016 TTCTCAATGGGGAAGGAGGAGGG + Intronic
970512231 4:16792801-16792823 TTTAACAAGAGGAAGGAGGAAGG + Intronic
973893620 4:55391574-55391596 TTATCAGAGGGGAATGACGAAGG + Intergenic
975664070 4:76716755-76716777 ATTCCCCAGGGAAATGAGGAAGG - Intronic
977686418 4:99851988-99852010 TTTTACAAGGGTCATCAGGAAGG - Intronic
978470788 4:109065133-109065155 AATTCCAAAGGGATTGAGGAGGG + Intronic
978718337 4:111873644-111873666 TTTTCCCAGGCGGATGAGGTGGG - Intergenic
980184168 4:129440915-129440937 TTTTCCAAAGGGAAGCAGAATGG - Intergenic
980308897 4:131101190-131101212 TTTTGCTAGGGCAGTGAGGAAGG + Intergenic
980683833 4:136200089-136200111 TTCTCGAGGGGGAATAAGGATGG + Intergenic
981139694 4:141254089-141254111 TGTTCCTAGGGGAAGGGGGATGG - Intergenic
981246530 4:142547146-142547168 CTTTCCCATGGCAATGAGGATGG + Intronic
981964896 4:150588493-150588515 TTTTCTAAATGGAATGTGGATGG - Intronic
982335260 4:154229406-154229428 TTTTGTAAGGGGAATTGGGATGG + Intergenic
983869061 4:172803444-172803466 TTTTCCATGGGGGCTGGGGAGGG - Intronic
983976688 4:173943452-173943474 TTTTCAAAGGACAATGAGGTGGG - Intergenic
985112323 4:186558360-186558382 TCTTCCCTGGGGAATGAGAAAGG + Intergenic
985219032 4:187683042-187683064 TCATGCAAGGAGAATGAGGAGGG + Intergenic
985899581 5:2778152-2778174 TTCTCAAGTGGGAATGAGGATGG + Intergenic
989123845 5:38032040-38032062 TTTTCCAAGGGAAAAGAGAGAGG + Intergenic
989478970 5:41905769-41905791 TCTTCCAAGGGAAATGAGAATGG - Intronic
991508111 5:67346037-67346059 TATACAAAGGGGAAAGAGGAAGG + Intergenic
992557010 5:77913787-77913809 TGTTCCAGGAGGAATGAGAAAGG - Intergenic
992738351 5:79746241-79746263 TTTTCTAAAGGGTAGGAGGATGG - Intronic
995849760 5:116532700-116532722 TTTTCCTAGGGAAAAGAGAAGGG - Intronic
997983098 5:138482333-138482355 TTGTACATGGGGAATGAAGATGG - Intergenic
998225831 5:140325545-140325567 TTTTCCCAGTTTAATGAGGAGGG - Intergenic
998922583 5:147085816-147085838 ATTTGCAATAGGAATGAGGAAGG + Intergenic
999069404 5:148727944-148727966 TCTTCCAAGGGTAATGGGGATGG - Intergenic
1000858378 5:166428386-166428408 TTTTCCAATGATAAAGAGGAGGG + Intergenic
1001226300 5:169947324-169947346 TTTTCCAAGGGGAATGAGGAGGG + Intronic
1002692724 5:181061663-181061685 TTTGAAAGGGGGAATGAGGAAGG + Intergenic
1003700058 6:8453845-8453867 TTGGCAAAGGGGAATGGGGAGGG - Intergenic
1003999954 6:11588461-11588483 TTTTGCAAGGTGAATGAGAAGGG + Intergenic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1007122812 6:39397429-39397451 TTTTCAAAGAGGAAAGAGGAAGG + Intronic
1007625950 6:43246589-43246611 TCTACCTAGGGGAGTGAGGAGGG - Exonic
1008003431 6:46384946-46384968 TAATCCAGGGGAAATGAGGAGGG + Intronic
1009042921 6:58202304-58202326 GTTGCCAAGGGTAATGGGGAGGG + Intergenic
1009218759 6:60956547-60956569 GTTGCCAAGGGTAATGGGGAGGG + Intergenic
1009227082 6:61029849-61029871 TTTTCCAAGGGGGAAGAAAATGG - Intergenic
1009641477 6:66342919-66342941 TTCTCCAATGGCAATGAGTATGG + Intergenic
1009922602 6:70080975-70080997 TTTTCAAAGTAAAATGAGGATGG + Intronic
1010349542 6:74856517-74856539 TTTTCCAAGGGATCTGAGAAAGG + Intergenic
1012344082 6:98166311-98166333 ATTTCCAAAGCTAATGAGGAGGG - Intergenic
1012430001 6:99154158-99154180 TTTACAAAGGGGAAGAAGGAAGG - Intergenic
1013282062 6:108647717-108647739 TTATCCAAGAGGAAAGGGGAGGG + Intronic
1013290007 6:108711750-108711772 TTTGCCAAGGGCAGTGGGGAGGG + Intergenic
1013778790 6:113707627-113707649 TTTTTGAGGGGGAATGAAGATGG + Intergenic
1013823063 6:114178768-114178790 TTTTCAAAGGGGAGAGATGAGGG + Intronic
1014723416 6:124947278-124947300 TTTTCATAGGGGAATGAGGTAGG + Intergenic
1017029280 6:150206620-150206642 TTCTACACGGGGCATGAGGATGG + Intronic
1017250674 6:152276659-152276681 TTCTCCAAGTAAAATGAGGAGGG - Intronic
1017557057 6:155583066-155583088 TCTGCCATGGGGAAGGAGGATGG + Intergenic
1018577825 6:165278020-165278042 TTTTCCAAGAGATCTGAGGAGGG - Intergenic
1019020661 6:168914928-168914950 TTTGCCACGCGGAATGAGCAGGG + Intergenic
1019697903 7:2457838-2457860 TCATCAAATGGGAATGAGGATGG - Intergenic
1020452976 7:8340884-8340906 TTTTGTAGGGAGAATGAGGATGG + Intergenic
1021170194 7:17390403-17390425 TTCTCCAAGGGGGATGGGAAAGG + Intergenic
1021938993 7:25660600-25660622 TTTGCCAAGGGCAATGAAAATGG - Intergenic
1023070437 7:36426480-36426502 TTTTCCAAAAGGAATTAGGATGG + Intronic
1023085759 7:36568676-36568698 TTTCTGAAGGGGATTGAGGAGGG - Intronic
1023975613 7:45027780-45027802 TATTCCATGGAGAATGAGGTAGG + Exonic
1024036486 7:45511233-45511255 TTTTCTAAGGTGAATGACTATGG + Intergenic
1028165941 7:87538680-87538702 TTTTCCTGGGGAAATGGGGAAGG - Intronic
1029102689 7:98146512-98146534 TAATCCAAAGGGAATGAGAAGGG - Intronic
1029109612 7:98206024-98206046 TTATTCGAGGGGAATGAGGCAGG + Exonic
1029924061 7:104297255-104297277 TTTCCCAAGCGAAATGAGAAGGG - Intergenic
1031052478 7:116957932-116957954 TTTTCCAAAAGGAATGAAAACGG - Intronic
1031787551 7:126053035-126053057 TTATCCAAGGGTAAGGAGGTAGG - Intergenic
1031920778 7:127599311-127599333 TTTCCCAAGTGGAAGCAGGAGGG - Intronic
1032155377 7:129463469-129463491 TTTTCAAAGGGGAAGATGGAAGG - Intronic
1032401078 7:131624817-131624839 CTTTCCACGAGGAATGAGGATGG - Intergenic
1033584556 7:142764457-142764479 ATTTTCCAGGTGAATGAGGAGGG - Intergenic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1034485504 7:151358622-151358644 TTTTCCATGGACAAGGAGGAAGG - Intronic
1034684971 7:152962411-152962433 ATTACCAAGGGTAATGGGGATGG + Intergenic
1037015817 8:13904812-13904834 TTTTCCCAGGAGATTGGGGAAGG - Intergenic
1037767895 8:21783040-21783062 TTCTCCCTGGGGTATGAGGAGGG - Intronic
1038637667 8:29300584-29300606 ATATCCAAGGGGAGAGAGGAAGG - Intergenic
1038848964 8:31255571-31255593 TTTCCCCTGGGGTATGAGGAAGG + Intergenic
1039738240 8:40355580-40355602 TTTTGCATGGGTAATGAAGAAGG - Intergenic
1041421717 8:57674092-57674114 TTTTCACAGGGGGATCAGGAAGG - Intergenic
1041789628 8:61678749-61678771 AGATCCAAGGGGAAGGAGGAGGG - Intronic
1043130549 8:76455771-76455793 TTTTCCTGGGGGAATGATGTGGG - Intergenic
1043132806 8:76482602-76482624 TTTGCCTAGGAAAATGAGGAAGG - Intergenic
1043690670 8:83146930-83146952 TTTTTCAAGGGGGTGGAGGATGG - Intergenic
1044668065 8:94651114-94651136 TTTTCCAGGGGGAATGGTGAGGG + Intronic
1045586360 8:103541558-103541580 CTTTCCAAGTGAAATGAGAAGGG + Intronic
1045873841 8:106956116-106956138 GTTTCAAAGGGGAATCAGTAAGG - Intergenic
1048069559 8:131007303-131007325 ATTTCCAAGGTGAAAGAGGTAGG + Intronic
1048206777 8:132421869-132421891 TTTTCCAAAGGGAGCCAGGATGG + Intronic
1049291460 8:141805140-141805162 GTATCCTAGGGGAAGGAGGATGG + Intergenic
1049870334 8:144970188-144970210 AATTCCATGGGAAATGAGGACGG - Intergenic
1050297954 9:4225865-4225887 TTCTTCAGGGGAAATGAGGAAGG + Intronic
1051347025 9:16161434-16161456 TTTGCCAAGGGTCATGGGGAAGG + Intergenic
1051508276 9:17848746-17848768 TTTTCCCAGGGGCTGGAGGAAGG - Intergenic
1051993885 9:23189850-23189872 TTTTGAAAGGAGAATGAGAAAGG - Intergenic
1052353366 9:27480104-27480126 ATTTTCAGGGGAAATGAGGAAGG + Intronic
1053279998 9:36814260-36814282 TATTACTAGGGGAGTGAGGAAGG + Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055938504 9:81626157-81626179 GTTCCCAAGGGGAATCAGCATGG - Intronic
1056261685 9:84855049-84855071 TGTTTCATGGGGAATGAGGCAGG + Intronic
1056459870 9:86799444-86799466 TTTCCCCAGGGGAATGATGGTGG + Intergenic
1056793047 9:89638512-89638534 TTCTCCACGAGGAATGAAGAGGG - Intergenic
1057431137 9:94995288-94995310 GTTTCTGAGGGGAAAGAGGAAGG + Intronic
1057618279 9:96613158-96613180 TCTTCACAGGGGAATGTGGAGGG + Intronic
1058127097 9:101207626-101207648 TTTTCCACGGTGAATGGGGGTGG - Intronic
1058944520 9:109843654-109843676 ATTTCCAGGGAGAAAGAGGATGG - Intronic
1060980669 9:127789773-127789795 GTTTCCATGGGGTAGGAGGATGG + Exonic
1061383957 9:130277163-130277185 TTTTCCACTGGGCAAGAGGAGGG - Intergenic
1062084223 9:134640734-134640756 TTGTTCAAAGGGAATGGGGATGG + Intergenic
1062158133 9:135065468-135065490 TTCCCCAAGGGGAAGCAGGATGG - Intergenic
1062704059 9:137925073-137925095 TTTTCCCTGGGGAACTAGGATGG - Intronic
1186024591 X:5295435-5295457 TTTCCCAGGTGGAATTAGGAGGG + Intergenic
1188217520 X:27497467-27497489 TTTGCCAAGGGCAAGAAGGATGG - Intergenic
1188685440 X:33063915-33063937 TTTTCTAAGTGGACTTAGGAAGG - Intronic
1190738412 X:53270949-53270971 TTTTAGAAGGGAAATGAGGGAGG - Intronic
1191936943 X:66436881-66436903 TTTTCCAGGGAGAAGGAGGCAGG - Intergenic
1192011306 X:67276836-67276858 CTTTCCTAGGGGAATGCGTAGGG - Intergenic
1192698383 X:73442848-73442870 AGTTCCAAAGGGATTGAGGAGGG + Intergenic
1194135369 X:90134139-90134161 TTTTCAAGGGAGAATGAGGGAGG - Intergenic
1194383316 X:93222384-93222406 ATTGCCAAGAGGAATGTGGAAGG - Intergenic
1194769429 X:97883233-97883255 TGTTCCACTGGGAATGTGGAGGG + Intergenic
1194972634 X:100360960-100360982 TTTGGGAAGGGGGATGAGGAGGG + Intronic
1195621143 X:106956095-106956117 CTTCCCAAGAGGAAGGAGGAAGG + Intronic
1195689328 X:107610927-107610949 TTTAGCAAGGAGGATGAGGATGG - Intergenic
1197288335 X:124623727-124623749 TTTTTAAAGGGCAATGAGGAAGG - Intronic
1198249915 X:134870169-134870191 TTGCCCAAAGGGAAAGAGGATGG + Intergenic
1199270939 X:145881915-145881937 TCTTGAAAGGGGAATGTGGATGG + Intergenic
1199719550 X:150532724-150532746 TTTTCCAAGGGGTTTGAGGATGG - Intergenic
1199893600 X:152112276-152112298 TTTTCCTAAGGGATTGAGTAGGG - Intergenic
1201150407 Y:11092564-11092586 TTTACCATGGGGGAGGAGGAGGG - Intergenic