ID: 1001233418

View in Genome Browser
Species Human (GRCh38)
Location 5:170009475-170009497
Sequence GAGGATTCAGGACATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 843
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 809}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001233418_1001233422 0 Left 1001233418 5:170009475-170009497 CCTTGCTCATGTCCTGAATCCTC 0: 1
1: 0
2: 0
3: 33
4: 809
Right 1001233422 5:170009498-170009520 CTTTATAAATATGTGCTGAAAGG No data
1001233418_1001233423 4 Left 1001233418 5:170009475-170009497 CCTTGCTCATGTCCTGAATCCTC 0: 1
1: 0
2: 0
3: 33
4: 809
Right 1001233423 5:170009502-170009524 ATAAATATGTGCTGAAAGGATGG 0: 1
1: 1
2: 9
3: 95
4: 633
1001233418_1001233426 12 Left 1001233418 5:170009475-170009497 CCTTGCTCATGTCCTGAATCCTC 0: 1
1: 0
2: 0
3: 33
4: 809
Right 1001233426 5:170009510-170009532 GTGCTGAAAGGATGGATGGGTGG 0: 1
1: 0
2: 4
3: 102
4: 918
1001233418_1001233427 16 Left 1001233418 5:170009475-170009497 CCTTGCTCATGTCCTGAATCCTC 0: 1
1: 0
2: 0
3: 33
4: 809
Right 1001233427 5:170009514-170009536 TGAAAGGATGGATGGGTGGATGG 0: 3
1: 70
2: 1471
3: 17422
4: 20427
1001233418_1001233424 8 Left 1001233418 5:170009475-170009497 CCTTGCTCATGTCCTGAATCCTC 0: 1
1: 0
2: 0
3: 33
4: 809
Right 1001233424 5:170009506-170009528 ATATGTGCTGAAAGGATGGATGG 0: 1
1: 0
2: 4
3: 43
4: 481
1001233418_1001233425 9 Left 1001233418 5:170009475-170009497 CCTTGCTCATGTCCTGAATCCTC 0: 1
1: 0
2: 0
3: 33
4: 809
Right 1001233425 5:170009507-170009529 TATGTGCTGAAAGGATGGATGGG 0: 1
1: 0
2: 3
3: 21
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001233418 Original CRISPR GAGGATTCAGGACATGAGCA AGG (reversed) Intronic
901015409 1:6226592-6226614 GAGAGGTCAGGACATGAGCCTGG - Intronic
901316560 1:8313988-8314010 GAGGACTGAGAACATGACCAAGG + Intergenic
903689634 1:25163688-25163710 TCGAAATCAGGACATGAGCATGG - Intergenic
904314340 1:29650608-29650630 CAGGATTCAAGGCAAGAGCAGGG + Intergenic
904384851 1:30134581-30134603 CAGGATTCAGGGCAGGAGCAGGG - Intergenic
904496199 1:30888236-30888258 TGGGATTCAGGACTGGAGCAGGG + Intronic
905817758 1:40965241-40965263 GAGGACTGAGGACATGGGCAAGG + Intergenic
906759675 1:48364872-48364894 TACCATTCAGGACATGGGCATGG - Intronic
906867319 1:49436170-49436192 GAGGTATCAGAAGATGAGCAAGG + Intronic
906883594 1:49620038-49620060 TACCATTCAGGACATAAGCATGG + Intronic
907946302 1:59139565-59139587 GGGGCTTCAGGACACAAGCAGGG - Intergenic
907997619 1:59648823-59648845 GACCATTCAGGACATAGGCATGG - Intronic
908058857 1:60324441-60324463 TATGATTCAGGACATAGGCATGG - Intergenic
908585121 1:65559624-65559646 GACCATTCAGGACATAGGCATGG - Intronic
908727658 1:67194191-67194213 GAGGCTTCATTACATAAGCACGG + Intronic
908904351 1:68990856-68990878 TAGCATTCAGGACATAGGCATGG + Intergenic
909333553 1:74445101-74445123 GACCATTCAGGACATAGGCATGG + Intronic
909595633 1:77403370-77403392 TACGATTCAGGACATAGGCATGG - Intronic
910067649 1:83172489-83172511 TACCATTCAGGACATAAGCATGG + Intergenic
910454613 1:87384065-87384087 TAGGAATCAGGAAATCAGCAAGG + Intergenic
911120191 1:94288571-94288593 TATCATTCAGGACATAAGCATGG - Intergenic
911202831 1:95063366-95063388 TAGTATTCAGGACACCAGCATGG - Intronic
911252140 1:95588884-95588906 TACTATTCAGGACATAAGCATGG + Intergenic
911462896 1:98213125-98213147 TACCATTCAGGACATAAGCATGG - Intergenic
911700350 1:100945360-100945382 TACCATTCAGGACATAAGCATGG - Intronic
912001161 1:104836509-104836531 CACCATTCAGGACATAAGCATGG + Intergenic
912019786 1:105093384-105093406 TACCATTCAGGACATAAGCATGG + Intergenic
912151963 1:106870593-106870615 TATCATTCAGGACATGGGCATGG - Intergenic
912872157 1:113318089-113318111 TATGATTCAGGACATAGGCATGG + Intergenic
913455409 1:119025551-119025573 TACCATTCAGGACATGGGCAAGG + Intergenic
913475261 1:119230902-119230924 GAAGATTCAGGTCAAGACCAAGG - Intergenic
915259122 1:154663259-154663281 GTGGTTTCAGGACATGACCCAGG - Intergenic
915715426 1:157940527-157940549 GAGGATTCAGGACAGGTGTATGG + Intergenic
916217772 1:162412165-162412187 CAAGATTCAGGAAATGAGGAGGG + Intergenic
916374297 1:164135263-164135285 GAGGAAACAGGACTAGAGCAGGG + Intergenic
916906043 1:169284657-169284679 TAGCATTCAGGACATAGGCATGG - Intronic
917055851 1:170980686-170980708 TACCATTCAGGACATAAGCATGG + Intronic
917289434 1:173457030-173457052 TACCATTCAGGACATGGGCATGG + Intergenic
917311109 1:173679612-173679634 TACCATTCAGGACATGGGCATGG + Intergenic
917413207 1:174781640-174781662 TACCATTCAGGACATAAGCATGG - Intronic
917744138 1:177991100-177991122 TACGATTCAGGACATAGGCATGG + Intergenic
918091620 1:181300087-181300109 AAAGATTCAGCACATTAGCAGGG + Intergenic
918860102 1:189813545-189813567 TATCATTCAGGACATAAGCATGG - Intergenic
919036422 1:192315484-192315506 CAGTATTCAGGACAGTAGCATGG - Intergenic
919177546 1:194037263-194037285 TACCATTCAGGACATAAGCATGG - Intergenic
919808036 1:201392362-201392384 GGGGAGTCAGACCATGAGCAAGG + Intronic
920628322 1:207626001-207626023 TAGGTTTCAGGTCCTGAGCAAGG + Intronic
921008886 1:211121598-211121620 TACCATTCAGGACATGGGCATGG + Intronic
921717061 1:218428409-218428431 TACCATTCAGGACATGGGCATGG - Intronic
921846803 1:219891748-219891770 TACCATTCAGGACATGGGCATGG + Intronic
923269620 1:232343622-232343644 TAGCATTCAGGACATAGGCATGG + Intergenic
923308362 1:232709439-232709461 GGGGATTCAGGGAAAGAGCATGG + Intergenic
923947411 1:238903673-238903695 GACCATTCAGGACATAGGCATGG + Intergenic
924827625 1:247557564-247557586 GAGGATTGAGGAGATGAGCCAGG + Intronic
924935618 1:248766697-248766719 TACCATTCAGGACATAAGCATGG + Intergenic
1063112160 10:3046756-3046778 GAGGAAGCAGGACATGAGTGGGG - Intergenic
1063334989 10:5203490-5203512 GAGAATTCAGGCCATGGGTAAGG - Intronic
1063896914 10:10692082-10692104 TACCATTCAGGACATAAGCATGG - Intergenic
1063933287 10:11050915-11050937 GAGGATTCAGGAGGAAAGCAGGG - Intronic
1065246461 10:23763666-23763688 TACCATTCAGGACATAAGCATGG + Intronic
1065562007 10:26972998-26973020 CAGGAATCTGGATATGAGCATGG - Intergenic
1066000324 10:31098948-31098970 TACCATTCAGGACATAAGCATGG - Intergenic
1066528710 10:36312305-36312327 GAGGATTCAGGAAGGGAGGAAGG - Intergenic
1066599486 10:37089355-37089377 TAGCATTCAGGACATAGGCATGG - Intergenic
1066655683 10:37697883-37697905 TACCATTCAGGACATGGGCATGG + Intergenic
1066788078 10:39028022-39028044 TACCATTCAGGACATGGGCATGG + Intergenic
1066961237 10:42230270-42230292 GAGGGTCCAGGACAAGGGCAAGG + Intergenic
1066983375 10:42440315-42440337 TACCATTCAGGACATGGGCATGG + Intergenic
1067240108 10:44483888-44483910 TACCATTCAGGACATAAGCATGG - Intergenic
1067261146 10:44692761-44692783 TAGCATTCAGGACATAGGCATGG + Intergenic
1067286762 10:44912668-44912690 AAGGATGCAGGAACTGAGCATGG + Intronic
1067340164 10:45394522-45394544 TACCATTCAGGACATAAGCATGG + Intronic
1067819615 10:49516975-49516997 GAGGAATCAGGAGATGAAGAAGG - Exonic
1067991000 10:51212383-51212405 TACCATTCAGGACATAAGCATGG + Intronic
1068296137 10:55074789-55074811 TAGCATTCAGGACATAGGCATGG - Intronic
1068477498 10:57547350-57547372 TAGCATTCAGGACATAGGCATGG - Intergenic
1068495786 10:57783894-57783916 TACCATTCAGGACATAAGCATGG + Intergenic
1068801416 10:61144844-61144866 GAGGATTAAGGAAATCAGTAAGG - Intergenic
1068935241 10:62629435-62629457 TACGATTCAGGACATAGGCATGG - Intronic
1069139469 10:64805380-64805402 TACCATTCAGGACATAAGCATGG - Intergenic
1069194118 10:65527280-65527302 TAGCATTCAGGACATAGGCATGG + Intergenic
1070619564 10:77998220-77998242 TAGCATTCAGGACATAGGCATGG + Intronic
1070852314 10:79575394-79575416 TAGCATTCAGGACATAGGCATGG + Intergenic
1071059508 10:81553189-81553211 TACCATTCAGGACATAAGCATGG + Intergenic
1071243971 10:83742302-83742324 TACCATTCAGGACATGGGCATGG - Intergenic
1071900342 10:90114149-90114171 TACCATTCAGGACATAAGCATGG - Intergenic
1072372413 10:94777719-94777741 TACCATTCAGGACATAAGCATGG + Intronic
1072414939 10:95239266-95239288 TACCATTCAGGACATGGGCATGG + Intronic
1072485672 10:95852504-95852526 TACTATTCAGGACATGGGCATGG - Intronic
1074875082 10:117607393-117607415 GTGGGTGCACGACATGAGCATGG + Intergenic
1075688590 10:124380345-124380367 GCGGAGTCAGGAGAGGAGCATGG - Intergenic
1075688600 10:124380393-124380415 GAGGATTCAGGGGAGGAGCTGGG - Intergenic
1075688608 10:124380423-124380445 GAGGAGTCAGGGGAGGAGCATGG - Intergenic
1076841008 10:133045189-133045211 GTGGATTGAGGACATGAGGCTGG + Intergenic
1077550277 11:3197118-3197140 GAAGTGTCAGGACATGAGCTGGG + Intergenic
1077903338 11:6508792-6508814 GAGGATACAGGAGATGAAAAAGG - Intronic
1078103904 11:8346410-8346432 GAGGGCCCAGGACATGGGCAAGG + Intergenic
1078305288 11:10178260-10178282 TACCATTCAGGACATAAGCATGG + Intronic
1078420560 11:11208657-11208679 GATGGTTCAGAACATGACCATGG + Intergenic
1078732444 11:13987625-13987647 TACCATTCAGGACATAAGCATGG - Intronic
1078742954 11:14085218-14085240 TATCATTCAGGACATAAGCATGG - Intronic
1078860913 11:15245343-15245365 GAAGATTAAGAATATGAGCAAGG + Intronic
1079036280 11:17022923-17022945 GAGGATTCAGTTCAGGATCATGG + Intergenic
1079337394 11:19582439-19582461 TACCATTCAGGACATAAGCATGG - Intronic
1079534162 11:21491271-21491293 TAGCATTCAGGACATAGGCATGG - Intronic
1079550684 11:21693621-21693643 TACTGTTCAGGACATGAGCATGG - Intergenic
1079971847 11:27044507-27044529 TATCATTCAGGACATAAGCATGG - Intronic
1080138319 11:28884593-28884615 TACCATTCAGGACATGGGCATGG + Intergenic
1080253576 11:30264216-30264238 TAGCATTCAGGACATAGGCATGG - Intergenic
1080378826 11:31745808-31745830 TATCATTCAGGACATAAGCATGG + Intronic
1080418027 11:32087878-32087900 GTGGTTTCAGGACATCATCAAGG - Intronic
1081143530 11:39533744-39533766 TACCATTCAGGACATAAGCATGG - Intergenic
1081149244 11:39606024-39606046 TAGCATTCAGGACATAGGCATGG + Intergenic
1081200091 11:40204871-40204893 AAGGTTTCTGGACATGAGCAGGG + Intronic
1081317294 11:41646143-41646165 TACCATTCAGGACATGGGCATGG - Intergenic
1081826686 11:46060884-46060906 TACCATTCAGGACATAAGCATGG - Intronic
1082118288 11:48351036-48351058 TACGATTCAGGACATAGGCATGG + Intergenic
1082148432 11:48700909-48700931 TACCATTCAGGACATGGGCATGG - Intergenic
1082269447 11:50153908-50153930 TACCATTCAGGACATGGGCATGG + Intergenic
1082298508 11:50474776-50474798 TACCATTCAGGACATAAGCATGG + Intergenic
1082648688 11:55759998-55760020 TACCATTCAGGACATGGGCATGG - Intergenic
1082672899 11:56057403-56057425 TAGCATTCAGGACATAGGCATGG + Intergenic
1082683013 11:56201853-56201875 GAGTTTTCAGGACATAGGCATGG - Intergenic
1083477061 11:62921546-62921568 GAGGAGAAAGGACATGAGGAAGG + Exonic
1085490687 11:76914116-76914138 TAGCATTCAGGACATAGGCATGG + Intronic
1085491965 11:76928534-76928556 TAGCATTCAGGACATAGGCATGG - Intronic
1085496272 11:76972844-76972866 GAGGACTCTGGACAGCAGCAGGG - Intronic
1086141120 11:83501585-83501607 GAGGTTTCAGGATTTGAGAATGG - Intronic
1086352146 11:85953082-85953104 TACCATTCAGGACATGGGCATGG - Intergenic
1086418411 11:86612983-86613005 TACCATTCAGGACATAAGCATGG - Intronic
1086536886 11:87857937-87857959 TAGCATTCAGGACATAGGCATGG - Intergenic
1086566821 11:88236593-88236615 GAGTGGTCAGGAGATGAGCAGGG - Intergenic
1086608909 11:88729947-88729969 TAGCATTCAGGACATAGGCATGG + Intronic
1086735202 11:90297753-90297775 TACCATTCAGGACATAAGCATGG - Intergenic
1086758112 11:90591420-90591442 TACGATTCAGGACATAGGCAGGG + Intergenic
1087080751 11:94168912-94168934 CAGGATTAAGGACATGACCAAGG + Intronic
1087588611 11:100155094-100155116 TACCATTCAGGACATAAGCATGG - Intronic
1087930831 11:103975565-103975587 TACCATTCAGGACATGGGCATGG - Intronic
1087931523 11:103983486-103983508 TACCATTCAGGACATGGGCATGG + Intronic
1088411868 11:109543226-109543248 TACCATTCAGGACATAAGCATGG + Intergenic
1088694162 11:112352329-112352351 TACCATTCAGGACATAAGCATGG - Intergenic
1089430369 11:118419018-118419040 GAGGATTAAGGTCATGGCCAAGG - Intronic
1089627875 11:119762900-119762922 GACAAAACAGGACATGAGCAAGG - Intergenic
1089932931 11:122332565-122332587 GAGGATTTAGTATATGAACAGGG - Intergenic
1089938150 11:122386903-122386925 GAGAATTAAGGAGAAGAGCATGG + Intergenic
1090895611 11:130971825-130971847 TACCATTCAGGACATAAGCATGG - Intergenic
1090897402 11:130990569-130990591 GAGCATTTAGCACATGATCAAGG + Intergenic
1090928001 11:131268831-131268853 TACCATTCAGGACATAAGCATGG - Intergenic
1091335096 11:134760509-134760531 GAGGATTCAGCACCAGAGCTCGG + Intergenic
1091417605 12:302588-302610 CACCATTCAGGACATGGGCATGG + Intronic
1091468914 12:709747-709769 GAGGTTTCATTACATGGGCATGG + Intergenic
1092309513 12:7337236-7337258 TACCATTCAGGACATAAGCACGG + Intergenic
1092314339 12:7394510-7394532 TACCATTCAGGACATAAGCATGG + Intronic
1092319984 12:7461927-7461949 TAGAGTTCAGGACATGGGCAGGG - Intronic
1092703708 12:11261382-11261404 TACCATTCAGGACATGGGCATGG + Intergenic
1092707060 12:11296442-11296464 TATCATTCAGGACATGGGCATGG + Intergenic
1092946020 12:13454793-13454815 GAGGATTCAATTCCTGAGCATGG + Intergenic
1093350345 12:18092267-18092289 TACCATTCAGGACATAAGCATGG - Intronic
1093660382 12:21749938-21749960 TACCATTCAGGACATAAGCATGG + Intronic
1093800177 12:23363226-23363248 TAGGATACAGGGCCTGAGCAGGG + Intergenic
1094262798 12:28520645-28520667 TAGCATTCAGGACATAGGCATGG - Intronic
1094273140 12:28639432-28639454 TAGCATTCAGGACATAGGCATGG + Intergenic
1094389939 12:29938431-29938453 GAAGAAACAGGACTTGAGCATGG + Intergenic
1095153123 12:38819207-38819229 TACGATTCAGGACATAGGCATGG - Intronic
1095210482 12:39488375-39488397 TACCATTCAGGACATGGGCATGG + Intergenic
1095620687 12:44249909-44249931 TACGATTCAGGACATGGGCATGG + Intronic
1095714943 12:45333816-45333838 GAGGATTTAGGACAATACCAAGG + Intronic
1095920178 12:47521629-47521651 TACCATTCAGGACATAAGCATGG - Intergenic
1096481051 12:51941311-51941333 GAGGAATGAGGACTTGGGCATGG + Intergenic
1097627498 12:62018741-62018763 TACCATTCAGGACATGGGCATGG + Intronic
1097828663 12:64200521-64200543 GACCATTCAGGACATAGGCATGG + Intronic
1098436603 12:70474780-70474802 TAGCATTCAGGACATAGGCAGGG + Intergenic
1098458536 12:70704475-70704497 GAGGATCCAGAACATCATCAGGG + Intronic
1098515277 12:71368455-71368477 CACCATTCAGGACATGGGCATGG + Intronic
1098677219 12:73304984-73305006 TACCATTCAGGACATGGGCATGG + Intergenic
1098844428 12:75518506-75518528 TAGCATTCAGGACATAGGCATGG - Intergenic
1099319697 12:81130701-81130723 TAGCATTCAGGACATAGGCATGG - Intronic
1099550601 12:84038841-84038863 TACCATTCAGGACATAAGCATGG - Intergenic
1099820007 12:87697344-87697366 TACCATTCAGGACATGGGCATGG - Intergenic
1100065043 12:90633624-90633646 TAGCATTCAGGACATAGGCATGG + Intergenic
1100068939 12:90686745-90686767 TACCATTCAGGACATAAGCATGG + Intergenic
1100171902 12:91984520-91984542 GAGGATGCAGGAAAAGAGGAAGG - Intergenic
1100853672 12:98739484-98739506 GATGATTCAGGTATTGAGCAAGG + Intronic
1100905326 12:99292074-99292096 TATGATTCAGGACATAGGCATGG + Intronic
1101118858 12:101558162-101558184 GACCATTCAGGACATAGGCATGG + Intergenic
1101280756 12:103252877-103252899 TACTATTCAGGACATGGGCATGG - Intronic
1102012490 12:109627211-109627233 GAGGATCCAGGCCAGGAGCTAGG - Intergenic
1102524990 12:113506071-113506093 GAGGGGTGAGGACAGGAGCAGGG - Intergenic
1102856393 12:116298258-116298280 TAGGATTGAGGAGATGGGCAAGG + Intergenic
1104193745 12:126510244-126510266 GAGGACTCAGGAGATGAAGAAGG + Intergenic
1104912303 12:132245127-132245149 GAGGAGTCAGGCCATCAGAAAGG + Intronic
1106694973 13:32163288-32163310 GAGGAAGCAGGACACGAGAATGG + Intronic
1107091602 13:36487272-36487294 TACCATTCAGGACATGGGCATGG - Intergenic
1107306386 13:39024715-39024737 GAGGATTGAGGACCTTATCAGGG - Intronic
1107314336 13:39115068-39115090 TACCATTCAGGACATGGGCATGG - Intergenic
1107322802 13:39207391-39207413 TACCATTCAGGACATGGGCATGG - Intergenic
1107712320 13:43162342-43162364 TACCATTCAGGACATGGGCATGG + Intergenic
1108857471 13:54812333-54812355 TAGCATTCAGGACATAGGCATGG - Intergenic
1109165352 13:59027701-59027723 TAGCATTCAGGACATAGGCATGG - Intergenic
1109388070 13:61658481-61658503 TACCATTCAGGACATTAGCATGG - Intergenic
1109925662 13:69135190-69135212 GAGGATAGAGGACAGGAGGAGGG - Intergenic
1109930133 13:69205499-69205521 AGGCATTCAGGACATAAGCATGG + Intergenic
1110349355 13:74489163-74489185 CACCATTCAGGACATAAGCATGG - Intergenic
1110631484 13:77713127-77713149 TACCATTCAGGACATGGGCATGG + Intronic
1110678869 13:78284252-78284274 TACGATTCAGGACATAGGCATGG - Intergenic
1110699582 13:78531107-78531129 TATCATTCAGGACATAAGCATGG + Intergenic
1110737004 13:78948891-78948913 TACCATTCAGGACATAAGCATGG - Intergenic
1110789649 13:79573746-79573768 TACCATTCAGGACATGGGCATGG + Intergenic
1111398526 13:87700546-87700568 TACCATTCAGGACATGGGCATGG - Intergenic
1111453088 13:88445177-88445199 GACTATTCAGGACATAGGCATGG - Intergenic
1111848506 13:93542097-93542119 TAGCATTCAGGACATAGGCATGG - Intronic
1112166308 13:96923784-96923806 TATGATTCAGGACATAGGCATGG + Intergenic
1113513481 13:110873337-110873359 GAGGTCTCAGGAAATGGGCAGGG - Intergenic
1113709732 13:112455332-112455354 TGGGATTCAGGACCTGAGGAAGG - Intergenic
1114079418 14:19190323-19190345 TACCATTCAGGACATAAGCATGG + Intergenic
1114517565 14:23309576-23309598 GAGGCATCAGGACAAGGGCAGGG - Exonic
1115124671 14:29977397-29977419 TACCATTCAGGACATGGGCATGG + Intronic
1115340514 14:32288839-32288861 TACCATTCAGGACATCAGCATGG - Intergenic
1115973142 14:38968262-38968284 TACCATTCAGGACATAAGCACGG + Intergenic
1116022381 14:39477082-39477104 CAGCATTCAGGACATAGGCATGG - Intergenic
1116193112 14:41685538-41685560 TACCATTCAGGACATAAGCATGG - Intronic
1116649960 14:47577357-47577379 TAGCATTCAGGACATAGGCACGG + Intronic
1116671747 14:47851029-47851051 GTGCATTCAGGACATTGGCATGG + Intergenic
1116728514 14:48592801-48592823 TACCATTCAGGACATAAGCATGG + Intergenic
1116784638 14:49273974-49273996 TACCATTCAGGACATAAGCATGG - Intergenic
1117574902 14:57088053-57088075 GAGCATTGAGGCCATGAGCCAGG + Intergenic
1117614695 14:57521641-57521663 TACCATTCAGGACATGGGCATGG - Intergenic
1117664718 14:58044532-58044554 TACCATTCAGGACATGGGCATGG + Intronic
1117755026 14:58965750-58965772 CAGGATTCTTGACATGAACAGGG + Intergenic
1118511111 14:66474484-66474506 TACCATTCAGGACATAAGCATGG + Intergenic
1118717993 14:68573886-68573908 GAGCATGCAGCACATGAGTATGG + Intronic
1118719222 14:68582075-68582097 TACCATTCAGGACATAAGCATGG + Intronic
1118907955 14:70036523-70036545 GACTCTTCAGGACATGAGTAGGG + Intergenic
1119994975 14:79243367-79243389 GGGGATTCAATACCTGAGCAGGG + Intronic
1120373455 14:83668737-83668759 TAGCATTCAGGACATAGGCATGG + Intergenic
1120670347 14:87355816-87355838 TAGCATTCAGGACATAGGCATGG - Intergenic
1120742470 14:88123280-88123302 TACCATTCAGGACATAAGCATGG - Intergenic
1121110233 14:91307545-91307567 GAGGATACAGGAGGTGAACAGGG + Intronic
1121295941 14:92823236-92823258 GAGAATTTAGGACATGATAAAGG - Intronic
1121785883 14:96660770-96660792 GAGGCAGCAGGAAATGAGCAGGG - Intergenic
1121905963 14:97745018-97745040 TATCATTCAGGACATAAGCATGG + Intergenic
1123214808 14:106797811-106797833 TACCATTCAGGACATAAGCATGG + Intergenic
1123443684 15:20306762-20306784 GAGGATCCAGAGCAAGAGCAGGG - Intergenic
1123572586 15:21629411-21629433 GACCATTCAGGACATAGGCATGG - Intergenic
1123609207 15:22071998-22072020 GACCATTCAGGACATAGGCATGG - Intergenic
1124133294 15:27009587-27009609 GAGCATTTAGAACATGAGTATGG - Intronic
1124625482 15:31305158-31305180 GAGGATGCAGGCCACCAGCAGGG - Intergenic
1124701078 15:31912699-31912721 TACCATTCAGGACATGGGCATGG - Intergenic
1125235408 15:37507145-37507167 TATGATTCAGGACATAGGCATGG - Intergenic
1125984637 15:44038364-44038386 TACCATTCAGGACATAAGCATGG - Intronic
1126177732 15:45753583-45753605 CACCATTCAGGACATGGGCATGG - Intergenic
1127000758 15:54501747-54501769 GAGGCTTCATGACAAGGGCAGGG + Intronic
1127158533 15:56154698-56154720 TAGTATTCAGGACATAGGCATGG + Intronic
1127580497 15:60334774-60334796 TACCATTCAGGACATAAGCATGG + Intergenic
1127660632 15:61097160-61097182 GAGGAAGCAGGATTTGAGCAGGG + Intronic
1129578951 15:76784947-76784969 TACCATTCAGGACATAAGCATGG + Intronic
1130811390 15:87382290-87382312 TACCATTCAGGACATGGGCAAGG + Intergenic
1130848762 15:87772941-87772963 TACCATTCAGGACATGGGCACGG + Intergenic
1130989133 15:88865336-88865358 GAGGAGTCAGGAAATGAGACTGG - Intronic
1132217179 15:100072824-100072846 TACCATTCAGGACATAAGCATGG + Intronic
1132287490 15:100674640-100674662 TAGCATTCAGGACATAGGCATGG - Intergenic
1132879054 16:2153250-2153272 GAGGATTCAGGCCCTGGGCTGGG - Intronic
1133000816 16:2850576-2850598 GAGACTCCAGGACAGGAGCAGGG + Intergenic
1133758827 16:8781985-8782007 GAGGATTCAGCTCAGGAGTAAGG + Exonic
1133959279 16:10478571-10478593 GACCATTCAGGACATAGGCATGG + Intronic
1136030781 16:27501325-27501347 CAGGATTCAGAAGATGATCATGG - Exonic
1136175512 16:28513653-28513675 GAGGCTTCAGGCCTTGATCAAGG - Intergenic
1136341079 16:29643841-29643863 GAGGATTGAGGACAACACCAAGG - Intergenic
1136601045 16:31288675-31288697 TACCATTCAGGACATAAGCATGG + Intronic
1137412577 16:48241962-48241984 TATCATTCAGGACATAAGCATGG + Intronic
1137894490 16:52196351-52196373 TATCATTCAGGACATAAGCATGG - Intergenic
1138307736 16:55993490-55993512 TAGGAATCAGGATCTGAGCAGGG + Intergenic
1138660319 16:58512661-58512683 GAAGGTTCTGGACATGAACAAGG + Exonic
1139355698 16:66366111-66366133 GAGGCTTCAGGAGATGGGAAAGG - Intergenic
1141316600 16:82968302-82968324 AAGGATTCAGGACATGAAGGTGG - Intronic
1143293356 17:5850629-5850651 TACCATTCAGGACATAAGCATGG - Intronic
1143984999 17:10905341-10905363 TACCATTCAGGACATAAGCATGG + Intergenic
1145250347 17:21293854-21293876 GAGGATGCAGGACAAGGGGAAGG - Intronic
1145686916 17:26678464-26678486 TACCATTCAGGACATAAGCATGG + Intergenic
1145713131 17:26994566-26994588 GAGCTTTCAGGACAAGAGGAGGG + Intergenic
1145726342 17:27129555-27129577 TAGCATTCAGGACATAGGCATGG - Intergenic
1145729320 17:27161536-27161558 GACCATTCAGGACATAGGCATGG - Intergenic
1145761485 17:27428094-27428116 TAGCATTCAGGACATAGGCATGG - Intergenic
1145968674 17:28940887-28940909 GAGAATACAGGACAGGAGCACGG - Intronic
1146104842 17:30025101-30025123 GACCATTCAGGACATAGGCATGG + Intronic
1146148136 17:30440483-30440505 GACCATTCAGGACATAGGCATGG - Intronic
1146440712 17:32892068-32892090 GACCATTCAGGACATAGGCATGG + Intergenic
1146908104 17:36630748-36630770 GAGGAGTTAGGAGATGGGCAGGG + Intergenic
1148622681 17:49046145-49046167 GAAGAGTCAGGACCTGAGCTTGG - Intronic
1149631835 17:58132128-58132150 TACTATTCAGGACATAAGCATGG + Intergenic
1149942205 17:60882515-60882537 GACCATTCAGGACATAGGCATGG - Intronic
1150285355 17:63950918-63950940 GGGGATTCAGGAGAGGAGCTAGG - Intronic
1150845764 17:68656285-68656307 GTGGGTGCAGCACATGAGCATGG + Intergenic
1150890167 17:69139013-69139035 TACCATTCAGGACATAAGCAGGG + Intronic
1151108520 17:71647843-71647865 TACCATTCAGGACATAAGCATGG + Intergenic
1152122097 17:78425141-78425163 GAGGATTCAGGGAATGTGCAGGG - Intronic
1152854080 17:82653961-82653983 GAGGGGGCAGGACAAGAGCAGGG + Intergenic
1153398615 18:4654976-4654998 GAGGAGCCAGGAAATTAGCAGGG + Intergenic
1154403904 18:14070041-14070063 TACTATTCAGGACATAAGCATGG + Intronic
1155120623 18:22815871-22815893 CTGGATTCAGGACAAGAGCTTGG - Intronic
1155660719 18:28245361-28245383 TACCATTCAGGACATAAGCATGG + Intergenic
1155673968 18:28407326-28407348 GAGGAATGAGGACATGAGGAGGG - Intergenic
1156161735 18:34367441-34367463 GAGGTTTGAGGCCATGTGCAAGG + Intergenic
1156653533 18:39255652-39255674 TACGATTCAGGACATAGGCATGG + Intergenic
1157066009 18:44351510-44351532 TACCATTCAGGACATAAGCATGG + Intergenic
1157151731 18:45225065-45225087 TAGCATTCAGGACATAGGCATGG - Intronic
1158072712 18:53492379-53492401 TACCATTCAGGACATAAGCACGG - Intronic
1159194043 18:65088227-65088249 TACCATTCAGGACATGGGCATGG - Intergenic
1161539672 19:4842669-4842691 GAGGACTCTGGACTTGAGCGAGG + Intronic
1161583662 19:5093823-5093845 GAGGAGACAGGACACGAACAAGG + Intronic
1164132661 19:22379488-22379510 TACCATTCAGGACATGGGCATGG - Intergenic
1164430346 19:28182528-28182550 TACCATTCAGGACATAAGCATGG + Intergenic
1164717008 19:30399489-30399511 TACCATTCAGGACATAAGCATGG - Intronic
1166027378 19:40099999-40100021 TACTATTCAGGACATAAGCATGG + Intergenic
1166904330 19:46095599-46095621 CACCATTCAGGACATAAGCATGG - Intergenic
1167270166 19:48501928-48501950 GAGGAGTCAGGAGAGGAGGAGGG - Intronic
1167308490 19:48722217-48722239 GAGGATACAGGAAATGAGTAGGG + Intronic
1167494837 19:49811606-49811628 GAGGTTGCAGGACATGAGGGTGG - Intronic
1168370292 19:55827332-55827354 GACCATTCAGGACATAGGCATGG + Intronic
1202663226 1_KI270708v1_random:91536-91558 TACCATTCAGGACATAAGCATGG + Intergenic
924968204 2:98309-98331 TACCATTCAGGACATGGGCATGG + Intergenic
925142460 2:1559418-1559440 GGGGGTTCAGGAGATGAGGAAGG - Intergenic
925283179 2:2699085-2699107 CAGGCTTCAGGACAGGAGCACGG + Intergenic
925467130 2:4116376-4116398 TACCATTCAGGACATAAGCATGG - Intergenic
925561010 2:5195502-5195524 CAGGAATCAAGACATCAGCAGGG + Intergenic
925876055 2:8312194-8312216 GAGGACTCAGGGCATGGGCAGGG - Intergenic
926798357 2:16637342-16637364 GAAGAATCAGGTCATGAGGATGG + Intronic
926906734 2:17812733-17812755 GAGCATTCATTACATGAGGAGGG - Intergenic
927078651 2:19605535-19605557 TACCATTCAGGACATAAGCACGG - Intergenic
928310486 2:30205535-30205557 CAGGATTCAGGACTGGGGCAAGG - Intergenic
928354401 2:30596716-30596738 TACCATTCAGGACATAAGCATGG - Intronic
928355218 2:30606655-30606677 TACCATTCAGGACATAAGCATGG + Intronic
928751127 2:34471567-34471589 TAGCATTCAGGACATAGGCATGG + Intergenic
928796164 2:35022149-35022171 TACCATTCAGGACATAAGCATGG - Intergenic
930346447 2:50188440-50188462 CACCATTCAGGACATAAGCATGG + Intronic
930525360 2:52522433-52522455 GAGAATTTAAGACCTGAGCAAGG - Intergenic
930951827 2:57151950-57151972 TACCATTCAGGACATGGGCATGG + Intergenic
930963132 2:57285396-57285418 TACCATTCAGGACATAAGCATGG + Intergenic
931846686 2:66211290-66211312 TACCATTCAGGACATGGGCATGG + Intergenic
931992438 2:67803877-67803899 GTGGATGCATGACATGACCAAGG + Intergenic
932111038 2:69000703-69000725 TACCATTCAGGACATGGGCATGG - Intergenic
932377110 2:71246507-71246529 TACCATTCAGGACATAAGCATGG - Intergenic
932662221 2:73665570-73665592 TACCATTCAGGACATGGGCATGG - Intergenic
932779288 2:74549793-74549815 GAGGATTCAGGGCACTAGGAAGG + Intronic
935439154 2:103071535-103071557 TACCATTCAGGACATAAGCATGG + Intergenic
935451690 2:103216827-103216849 GACCATTCAGGACATAGGCATGG + Intergenic
935475613 2:103518186-103518208 TACCATTCAGGACATGGGCATGG + Intergenic
935630079 2:105206880-105206902 TACCATTCAGGACATGGGCATGG - Intergenic
936274450 2:111082087-111082109 TAGCATTCAGGACATAGGCATGG + Intronic
936774892 2:115961117-115961139 TACTATTCAGGACATAAGCATGG - Intergenic
937085548 2:119169385-119169407 GAGGTTTCAGAAGATGAGAAAGG - Intergenic
937540461 2:122945633-122945655 GAGGATTCAAGATTTCAGCAGGG - Intergenic
937595203 2:123663938-123663960 GATGAATCAGTAAATGAGCAAGG - Intergenic
937723710 2:125133887-125133909 TATGATTCAGGACATAGGCATGG + Intergenic
939226584 2:139372254-139372276 TACCATTCAGGACATAAGCATGG + Intergenic
939357469 2:141122168-141122190 TAGCATTCAGGACATAGGCATGG + Intronic
939744031 2:145947259-145947281 TAGCATTCAGGACATAGGCATGG - Intergenic
939753810 2:146084311-146084333 AAGCATTCAGGACATAGGCATGG + Intergenic
940371025 2:152900937-152900959 TACCATTCAGGACATAAGCATGG + Intergenic
940560644 2:155291545-155291567 TACCATTCAGGACATAAGCATGG - Intergenic
941040994 2:160623666-160623688 TAGCATTCAGGACATAGGCATGG - Intergenic
941088082 2:161142395-161142417 GACCATTCAGGACATAGGCATGG - Intronic
941100648 2:161291245-161291267 GACTATTCAGGACATAGGCATGG + Intergenic
941513749 2:166445944-166445966 TACGATTCAGAACATAAGCATGG + Intronic
941603418 2:167565424-167565446 TAGCATTCAGGACATAGGCAAGG + Intergenic
941788911 2:169529090-169529112 GAGAATTCAGTAAATGAGCTTGG - Intergenic
942065339 2:172265778-172265800 TACCATTCAGGACATAAGCATGG - Intergenic
942372277 2:175297895-175297917 TACCATTCAGGACATGGGCATGG + Intergenic
942638648 2:178036939-178036961 TACGATTCAGGACATAGGCATGG + Intronic
943054628 2:182960649-182960671 TACCATTCAGGACATAAGCATGG + Intronic
943067316 2:183102228-183102250 TACCATTCAGGACATAAGCATGG - Intergenic
943074255 2:183175437-183175459 CACCATTCAGGACATAAGCATGG - Intergenic
943368530 2:186987042-186987064 TACCATTCAGGACATAAGCATGG - Intergenic
943959913 2:194251089-194251111 TACCATTCAGGACATGGGCATGG - Intergenic
943974986 2:194462676-194462698 TACCATTCAGGACATGGGCATGG + Intergenic
944210347 2:197200308-197200330 GAGGAGGCAGGACTTGAACAAGG + Intronic
944292504 2:198023316-198023338 TACCATTCAGGACATAAGCATGG + Intronic
945380759 2:209137288-209137310 TACCATTCAGGACATGGGCATGG - Intergenic
945391138 2:209266437-209266459 TACCATTCAGGACATGGGCATGG + Intergenic
945425137 2:209691754-209691776 AAGGATTGAGGTCATGACCATGG + Intronic
945535998 2:211018762-211018784 TAGCATTCAGGACATAAGAATGG - Intergenic
945830920 2:214783936-214783958 TACCATTCAGGACATGGGCATGG + Intronic
947033940 2:225829617-225829639 TACCATTCAGGACATAAGCATGG + Intergenic
947680941 2:232032575-232032597 TACCATTCAGGACATAAGCATGG - Intronic
947915079 2:233826639-233826661 TACCATTCAGGACATGGGCATGG + Intronic
947956156 2:234193534-234193556 TATGATTCAGGACATAGGCATGG + Intergenic
948189075 2:236044536-236044558 CAGGATTCTAGACATGAGAAAGG - Intronic
948680817 2:239633682-239633704 GAGGACTCAGGACTTGGGCTGGG - Intergenic
1169312014 20:4550951-4550973 GATTAATCAGGATATGAGCAAGG - Intergenic
1169741956 20:8904350-8904372 GGGGATTCAGGACAGCTGCATGG + Intronic
1170071082 20:12369477-12369499 TACCATTCAGGACATGGGCACGG + Intergenic
1170514590 20:17115862-17115884 TACCATTCAGGACATAAGCATGG - Intergenic
1170535201 20:17334347-17334369 GAGGACACTGGAAATGAGCATGG + Intronic
1170793132 20:19524182-19524204 GAGGTTCCAGGAGAGGAGCAGGG - Intronic
1171245141 20:23604674-23604696 GAGGAGGCAGCAAATGAGCAAGG + Intronic
1171434541 20:25110313-25110335 TACCATTCAGGACATAAGCATGG + Intergenic
1171741652 20:28900826-28900848 GACCATTCAGGACATAGGCATGG - Intergenic
1171763750 20:29237395-29237417 TACCATTCAGGACATAAGCATGG + Intergenic
1172417898 20:34786892-34786914 TACCATTCAGGACATGGGCATGG + Intronic
1172948036 20:38703615-38703637 GTGGAGTGAGGACAGGAGCAGGG - Intergenic
1173636927 20:44567734-44567756 CAGGATTAAGAACAGGAGCAGGG + Intronic
1173798345 20:45878409-45878431 CATGATTCAGGACCTAAGCAGGG + Exonic
1174408805 20:50320731-50320753 GAGGATTCAGGACAGAAGCCAGG - Intergenic
1178348346 21:31851257-31851279 GAGGATTCTGAATAAGAGCATGG - Intergenic
1178881774 21:36455614-36455636 GGGGATTCAGCACAGGAGCCAGG - Intergenic
1178904169 21:36622980-36623002 AAGGATTCAGGAAATGCTCATGG - Intergenic
1179183224 21:39062487-39062509 GAGGCCTCAGGCCATGTGCAGGG + Intergenic
1179293306 21:40038084-40038106 TACCATTCAGGACATAAGCATGG + Intronic
1179402997 21:41101879-41101901 GAGGAGTGAGGACAACAGCATGG + Intergenic
1180375432 22:12088466-12088488 TACCATTCAGGACATAAGCATGG + Intergenic
1180501350 22:15932375-15932397 TACCATTCAGGACATAAGCATGG - Intergenic
1180610688 22:17095789-17095811 GAGAATTCAGGAGCTGAACAGGG + Intronic
1182828537 22:33285815-33285837 AAGGACACAGGACATCAGCAGGG + Intronic
1183182322 22:36268422-36268444 AATGATCCAGGACATGGGCAGGG - Intergenic
1183660518 22:39217872-39217894 TACCATTCAGGACATAAGCATGG + Intergenic
1183749056 22:39709013-39709035 GTGGCTTCAGGACATGCGTACGG + Intergenic
1184349799 22:43936118-43936140 GAGGGTTGAGGACATTAGGAGGG + Intronic
1185074658 22:48676761-48676783 GAGAAACCAGGACTTGAGCAGGG - Intronic
1185092249 22:48782317-48782339 CAGGATTCAGGAAGAGAGCAGGG - Intronic
1185420781 22:50733082-50733104 GAGGCCTCAGGACTGGAGCAGGG - Intergenic
949277029 3:2295751-2295773 TACGATTCAGGACATAGGCATGG - Intronic
949717096 3:6946133-6946155 TATGATTCAGGACATAGGCATGG - Intronic
949873124 3:8606338-8606360 GAGTAATCAGGTCATGAGCATGG - Intergenic
950576702 3:13836535-13836557 GTGGATGGAGGACATGACCAGGG - Intronic
951164016 3:19462715-19462737 TACCATTCAGGACATAAGCATGG - Intronic
951238868 3:20266918-20266940 TACCATTCAGGACATAAGCATGG - Intergenic
951254012 3:20428210-20428232 TACGATTCAGGACATAGGCATGG - Intergenic
951346753 3:21556296-21556318 TACCATTCAGGACATAAGCATGG - Intronic
951448172 3:22806307-22806329 GACCATTCAGGACATCGGCATGG + Intergenic
951451788 3:22848397-22848419 GACCATTCAGGACATAGGCATGG - Intergenic
951477656 3:23125656-23125678 GAGGAATCAGGACAAGAGTCTGG + Intergenic
951511750 3:23510172-23510194 GAAGAGTCAGTACATGATCATGG + Intronic
951742161 3:25936539-25936561 TACGATTCAGGACATAGGCATGG + Intergenic
951964273 3:28365221-28365243 TACCATTCAGGACATAAGCATGG - Intronic
951977383 3:28527887-28527909 TACCATTCAGGACATAAGCATGG - Intronic
952182235 3:30929858-30929880 GACCATTCAGGACATAGGCATGG + Intergenic
954376400 3:50196159-50196181 GAGGATTCAGGATAGGACAAAGG + Exonic
955076256 3:55616367-55616389 AAGTATTCTGGACCTGAGCAAGG + Intronic
955599910 3:60634101-60634123 GAGGAGTCAGGACATGGCCAAGG - Intronic
955937736 3:64118262-64118284 TATCATTCAGGACATGGGCACGG + Intronic
956046816 3:65204548-65204570 GAGGATTCTGGACATGTTCAGGG - Intergenic
956079506 3:65542818-65542840 TATCATTCAGGACATAAGCATGG + Intronic
956587554 3:70880585-70880607 GAGGATTCAGCCAATGAGAAAGG + Intergenic
956985783 3:74698601-74698623 GGGGATTCAGGACACAAACAAGG - Intergenic
957256155 3:77840501-77840523 TAGCATTCAGGACATAGGCATGG - Intergenic
957666947 3:83244913-83244935 TACCATTCAGGACATGGGCATGG - Intergenic
958070951 3:88610504-88610526 GAGGAACCAGGACATGACCAGGG + Intergenic
958092385 3:88893132-88893154 TACCATTCAGGACATAAGCATGG + Intergenic
958159150 3:89794317-89794339 TAGCATTCAGGACATAGGCATGG - Intergenic
958423490 3:93954643-93954665 TAGCATTCAGGACATAGGCATGG + Intronic
958495683 3:94840986-94841008 TACCATTCAGGACATAAGCATGG + Intergenic
958519025 3:95159811-95159833 TACCATTCAGGACATGGGCATGG + Intergenic
959092611 3:101920129-101920151 TATGATTCAGGACATTGGCATGG - Intergenic
959407243 3:105975489-105975511 TAGGATGAAGGACATGAGGACGG - Intergenic
959422485 3:106146253-106146275 TACCATTCAGGACATAAGCATGG - Intergenic
959556398 3:107724481-107724503 TAGCATTCAGGACATAGGCATGG - Intronic
959740333 3:109711254-109711276 TACCATTCAGGACATGGGCATGG + Intergenic
960276305 3:115733225-115733247 TACCATTCAGGACATAAGCATGG - Intergenic
960360002 3:116699442-116699464 TAGCATTCAGGACATAGGCATGG + Intronic
960449028 3:117783047-117783069 TAGCATTCAGGACATAGGCATGG + Intergenic
960721704 3:120630692-120630714 TACCATTCAGGACATCAGCATGG + Intronic
960783975 3:121351757-121351779 TACCATTCAGGACATGGGCAAGG - Intronic
961326829 3:126113786-126113808 CAGGAGTCAGGACAGGACCAAGG + Intronic
961418623 3:126781585-126781607 GAGGGGTCAGGACTGGAGCAAGG + Intronic
961997761 3:131264286-131264308 TACCATTCAGGACATGGGCATGG - Intronic
962138341 3:132761727-132761749 TACCATTCAGGACATGGGCATGG - Intergenic
962642032 3:137397577-137397599 TAGCATTCAGGACATAGGCATGG + Intergenic
962663935 3:137634783-137634805 GACCATTCAGGACATAGGCATGG - Intergenic
963303621 3:143625682-143625704 TACCATTCAGGACATAAGCATGG + Intronic
963344755 3:144081814-144081836 TATGATTCAAGACATAAGCATGG + Intergenic
964136205 3:153347594-153347616 TACCATTCAGGACATAAGCATGG - Intergenic
964264612 3:154880046-154880068 TAGCATTCAGGACATAGGCATGG + Intergenic
964286142 3:155120489-155120511 GACCATTCAGGACATAGGCATGG - Intronic
964545773 3:157831493-157831515 CAGCATTCAGGACAAGAGGAAGG - Intergenic
965004680 3:163005009-163005031 TACCATTCAGGACATAAGCATGG + Intergenic
965137101 3:164785863-164785885 TACCATTCAGGACATAAGCATGG - Intergenic
965692379 3:171371503-171371525 GATTTTTCAGGACATGAGCATGG - Intronic
965947457 3:174260758-174260780 TACCATTCAGGACATAAGCATGG - Intronic
966134022 3:176677886-176677908 TAGCATTCAGGACATAGGCATGG + Intergenic
969009816 4:4052651-4052673 TACGATTCAGGACATAGGCATGG + Intergenic
969138012 4:5046433-5046455 TACCATTCAGGACATAAGCATGG + Intergenic
969626275 4:8307296-8307318 GAGGAGCCAGGACTTGAGCCGGG - Intergenic
969644042 4:8416186-8416208 GAGGAGTCTGGAAATGAACACGG - Intronic
970038882 4:11773269-11773291 GAAGAACCAGGACTTGAGCATGG + Intergenic
970144557 4:13021383-13021405 GAGGATTTTGGTCATGAGCATGG - Intergenic
970306334 4:14736108-14736130 CAGGATCCAGGAAATGACCATGG - Intergenic
970494766 4:16614336-16614358 TACCATTCAGGACATAAGCATGG + Intronic
971018366 4:22510730-22510752 GAGAAGTTAGGACTTGAGCATGG - Intronic
971723147 4:30273169-30273191 TAGCATTCAGGACATAGGCATGG - Intergenic
972973685 4:44607641-44607663 GATGATTAAGGAAATGAACATGG - Intergenic
973065302 4:45782623-45782645 TACCATTCAGGACATGGGCATGG + Intergenic
973097045 4:46215198-46215220 TACCATTCAGGACATGGGCATGG + Intergenic
973098557 4:46232456-46232478 TACCATTCAGGACATGGGCATGG - Intergenic
973139888 4:46753630-46753652 TACCATTCAGGACATGGGCATGG + Intronic
973185937 4:47328386-47328408 GACCATTCAGGACATAGGCATGG - Intronic
973288289 4:48444091-48444113 GACCATTCAGGACATACGCATGG - Intergenic
973290909 4:48469596-48469618 TATCATTCAGGACATAAGCATGG - Intergenic
973315739 4:48758152-48758174 TACCATTCAGGACATGGGCATGG + Intronic
973790187 4:54371042-54371064 AAGGATTCAGGGCATGAGGATGG + Intergenic
973920888 4:55683736-55683758 TAGCATTCAGGACATAGGCATGG - Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
974105579 4:57466382-57466404 GTAGGTTCAGGACATGAGCCTGG + Intergenic
974130086 4:57743830-57743852 TACAATTCAGGACATAAGCATGG - Intergenic
974668267 4:64994038-64994060 GACCATTCAGGACATAGGCATGG - Intergenic
974683967 4:65200158-65200180 GACCATTCAGGACATAGGCATGG + Intergenic
974689151 4:65272655-65272677 TATGATTCAGGACATAGGCATGG - Intergenic
974735633 4:65928058-65928080 TACCATTCAGGACATAAGCATGG - Intergenic
974750393 4:66133081-66133103 TACCATTCAGGACATAAGCATGG + Intergenic
974758978 4:66250648-66250670 GACCATTCAGGACATAGGCATGG + Intergenic
974819086 4:67043708-67043730 GAGGAGTCATGACATTGGCAGGG - Intergenic
974861325 4:67525244-67525266 TACCATTCAGGACATAAGCATGG + Intronic
975002174 4:69238031-69238053 TACCATTCAGGACATAAGCATGG + Intergenic
975007736 4:69311668-69311690 TACCATTCAGGACATAAGCATGG - Intronic
975179675 4:71330651-71330673 TACCATTCAGGACATAAGCATGG + Intronic
975519959 4:75290025-75290047 GAGGGTTCAGGGCATAGGCAGGG + Intergenic
975953704 4:79808800-79808822 TACCATTCAGGACATAAGCATGG - Intergenic
976038668 4:80856477-80856499 TACCATTCAGGACATGGGCATGG - Intronic
976793215 4:88903693-88903715 TACCATTCAGGACATAAGCATGG + Intronic
977717619 4:100199632-100199654 GAGGTTTCAGGAGAGGGGCAGGG - Intergenic
977828198 4:101558261-101558283 GACTATTCAGGACATAGGCATGG + Intronic
978022146 4:103827513-103827535 TACCATTCAGGACATAAGCATGG - Intergenic
978064934 4:104385716-104385738 TAGGATTGAGTTCATGAGCATGG - Intergenic
979141388 4:117180455-117180477 TATCATTCAGGACATCAGCATGG - Intergenic
979214804 4:118150303-118150325 TACCATTCAGGACATAAGCACGG + Intronic
979697842 4:123634343-123634365 TACCATTCAGGACATAAGCATGG - Intergenic
979711112 4:123780422-123780444 TACCATTCAGGACATAAGCATGG - Intergenic
979804248 4:124951159-124951181 TAGCATTCAGGACATAGGCATGG - Intergenic
979976908 4:127208205-127208227 TACCATTCAGGACATAAGCATGG - Intergenic
979990098 4:127365123-127365145 GAGAATTCAGGCTATGAGCAAGG - Intergenic
980183771 4:129435296-129435318 TACCATTCAGGACATAAGCATGG + Intergenic
981367221 4:143917416-143917438 TAGCATTCAGGACATAGGCATGG - Intergenic
981377012 4:144027649-144027671 TAGCATTCAGGACATAGGCATGG - Intergenic
981391257 4:144194422-144194444 TACCATTCAGGACATGGGCAAGG - Intergenic
982394071 4:154897043-154897065 TACCATTCAGGACATGGGCATGG + Intergenic
982437525 4:155395992-155396014 TAGCATTCAGGACATAGGCATGG - Intergenic
982625018 4:157755893-157755915 TACCATTCAGGACATAAGCATGG - Intergenic
983422593 4:167538928-167538950 TATCATTCAGGACATAAGCATGG + Intergenic
983748253 4:171229042-171229064 AAGCATTCAGGACATTGGCATGG + Intergenic
983819859 4:172179730-172179752 GACCATTCAGGACATAGGCATGG - Intronic
983950110 4:173629233-173629255 TACCATTCAGGACATAAGCAAGG + Intergenic
984163329 4:176280473-176280495 TACCATTCAGGACATGGGCATGG - Intergenic
984525696 4:180856943-180856965 TACCATTCAGGACATAAGCATGG - Intergenic
985193508 4:187403234-187403256 TACCATTCAGGACATAAGCATGG - Intergenic
985389363 4:189479184-189479206 TACCATTCAGGACATAAGCATGG + Intergenic
1202757027 4_GL000008v2_random:73907-73929 TACCATTCAGGACATAAGCATGG + Intergenic
985468745 5:23359-23381 TACCATTCAGGACATAAGCATGG + Intergenic
985702929 5:1384352-1384374 GAGGTTTCTGGAGATGAGCCTGG - Intergenic
985943330 5:3156279-3156301 GAGTATTCATTACATTAGCATGG + Intergenic
986199579 5:5569275-5569297 GATGAGACAGGACATGATCATGG - Intergenic
986482236 5:8201344-8201366 GTGGATTCTGGACATTAGGAAGG - Intergenic
986705110 5:10448114-10448136 GAGGAACCAGGACATAAGCCCGG + Intronic
986969333 5:13313991-13314013 GAGCATTCAGGACACAGGCATGG + Intergenic
987073503 5:14359612-14359634 GAGGACACAGGACCTCAGCAGGG - Intronic
987543108 5:19280263-19280285 GATGGTTCAGGACCAGAGCAAGG - Intergenic
988209569 5:28185603-28185625 TACCATTCAGGACATAAGCATGG - Intergenic
988333793 5:29877997-29878019 GACCATTCAGGACATAGGCATGG - Intergenic
988515175 5:31898311-31898333 TAGGCTTCAGGACATTAGGAAGG + Intronic
989356643 5:40551012-40551034 TACCATTCAGGACATAAGCACGG - Intergenic
989397309 5:40971660-40971682 TACCATTCAGGACATAAGCATGG - Intronic
989461536 5:41705100-41705122 TAGAATTCAGGACATAGGCAAGG - Intergenic
989614299 5:43323963-43323985 TACCATTCAGGACATAAGCATGG - Intergenic
989696128 5:44202733-44202755 TACGATTCAGGACATAGGCATGG - Intergenic
990234923 5:53756816-53756838 TACCATTCAGGACATAAGCATGG + Intergenic
990803962 5:59636821-59636843 TACCATTCAGGACATAAGCATGG + Intronic
991161849 5:63512349-63512371 TACCATTCAGGACATAAGCATGG + Intergenic
992026544 5:72675389-72675411 TACCATTCAGGACATAAGCATGG - Intergenic
992803452 5:80314271-80314293 TACCATTCAGGACATGGGCATGG - Intergenic
993265935 5:85726366-85726388 TACCATTCAGGACATAAGCATGG + Intergenic
993402092 5:87466351-87466373 TACCATTCAGGACATGGGCATGG - Intergenic
993445755 5:88010542-88010564 GACCATTCAGGACATAGGCATGG - Intergenic
993507389 5:88726741-88726763 GAGGTTTCAGAAAATGAGAAAGG - Intronic
993544575 5:89195389-89195411 TACCATTCAGGACATAAGCATGG - Intergenic
994233241 5:97333469-97333491 TATGATTCAGGACATAGGCATGG - Intergenic
994304848 5:98190858-98190880 TAGCATTCAGGACATAGGCATGG - Intergenic
994504875 5:100629752-100629774 TAGCATTCAGGACATAGGCATGG - Intergenic
994907114 5:105855271-105855293 TAGCATTCAGGACATAGGCATGG + Intergenic
995162294 5:108996335-108996357 TACCATTCAGGACATGGGCATGG - Intronic
995204380 5:109462297-109462319 TACCATTCAGGACATAAGCATGG + Intergenic
995306319 5:110654971-110654993 TATGATTCAGGACATAGGCATGG + Intronic
995618453 5:113994815-113994837 TATGATTCAGGACATAGGCATGG - Intergenic
995668558 5:114573561-114573583 TACCATTCAGGACATGGGCACGG + Intergenic
995785525 5:115823636-115823658 TACCATTCAGGACATAAGCATGG - Intergenic
995893791 5:116986969-116986991 TACCATTCAGGACATAAGCATGG + Intergenic
996060269 5:119025228-119025250 TACCATTCAGGACATCAGCATGG - Intergenic
996902242 5:128555687-128555709 TACCATTCAGGACATAAGCATGG + Intronic
997108819 5:131051315-131051337 TACCATTCAGGACATGGGCATGG + Intergenic
998972316 5:147606256-147606278 TACCATTCAGGACATAAGCATGG - Intronic
999485766 5:151993950-151993972 TACCATTCAGGACATAAGCATGG + Intergenic
999598117 5:153228412-153228434 TAGCATTCAGGACATAGGCATGG + Intergenic
1000155606 5:158548574-158548596 TACCATTCAGGACATAAGCATGG - Intergenic
1000816554 5:165929806-165929828 CTGGATTCAGGACATAGGCATGG + Intergenic
1001066355 5:168537883-168537905 GAAGATGCAGAGCATGAGCAGGG + Intergenic
1001105670 5:168852063-168852085 GAGTATTCATGACATCAGCAAGG - Intronic
1001149261 5:169212693-169212715 TATGATTCAGGACATAGGCATGG - Intronic
1001233418 5:170009475-170009497 GAGGATTCAGGACATGAGCAAGG - Intronic
1002672642 5:180881473-180881495 TACCATTCAGGACATAAGCATGG - Intergenic
1002684072 5:180993304-180993326 GAGGTTTCTGGAGATGAGCCTGG + Intronic
1003647947 6:7930735-7930757 TACCATTCAGGACATAAGCATGG + Intronic
1004017772 6:11747869-11747891 GAGGAATAAGGACATGATCATGG - Intronic
1006072070 6:31505504-31505526 GAGGAGGCAGGAAATGCGCATGG - Intronic
1006187504 6:32189629-32189651 GAAGATTCAGAACATGTGAACGG + Intronic
1006399632 6:33809607-33809629 GAGGTTTTAGGCCATGAGGATGG + Intergenic
1007386056 6:41520924-41520946 GAGGATGCAGGACTTAAGCTGGG + Intergenic
1007931547 6:45696159-45696181 TAGCATTCAGGACATAGGCACGG + Intergenic
1007955238 6:45912079-45912101 GCAAATTCAGAACATGAGCATGG - Intronic
1008069915 6:47088919-47088941 TAGCATTCAGGACATAGGCATGG + Intergenic
1008238234 6:49075768-49075790 TACCATTCAGGACATAAGCATGG - Intergenic
1008737032 6:54557479-54557501 TATCATTCAGGACATGGGCATGG + Intergenic
1009226213 6:61022456-61022478 TATCATTCAGGACATAAGCATGG - Intergenic
1009271753 6:61623182-61623204 TCGGATTCAGGAACTGAGCAAGG - Intergenic
1009504303 6:64455594-64455616 GAGGATTGGGGACATGGGGAGGG - Intronic
1009708703 6:67289630-67289652 TACCATTCAGGACATAAGCATGG + Intergenic
1009956029 6:70454481-70454503 TACCATTCAGGACATGGGCATGG - Intronic
1010004337 6:70979205-70979227 TACCATTCAGGACATGGGCATGG + Intergenic
1010129512 6:72474491-72474513 TATCATTCAGGACATAAGCATGG + Intergenic
1010315369 6:74442760-74442782 TACCATTCAGGACATAAGCATGG - Intergenic
1010321238 6:74512809-74512831 TACCATTCAGGACATGGGCATGG + Intergenic
1010482140 6:76368413-76368435 TACCATTCAGGACATAAGCATGG - Intergenic
1010482326 6:76370499-76370521 TACCATTCAGGACATAAGCATGG - Intergenic
1010730905 6:79390248-79390270 TAGCATTCAGGACATAGGCATGG + Intergenic
1010868807 6:81013148-81013170 TACCATTCAGGACATAAGCATGG - Intergenic
1010901335 6:81431921-81431943 TACCATTCAGGACATAAGCATGG - Intergenic
1010997336 6:82548882-82548904 TATGATTCAGGACATAGGCATGG + Intergenic
1011082087 6:83500706-83500728 TACCATTCAGGACATAAGCATGG + Intergenic
1011925581 6:92640622-92640644 TACCATTCAGGACATAAGCATGG + Intergenic
1011925793 6:92643867-92643889 TACCATTCAGGACATAAGCATGG - Intergenic
1011926533 6:92652224-92652246 TACCATTCAGGACATAAGCATGG - Intergenic
1012081443 6:94762824-94762846 TAGCATTCAGGACATAGGCATGG + Intergenic
1012095042 6:94947063-94947085 TAGCATTCAGGACATAGGCATGG + Intergenic
1012167230 6:95972284-95972306 TACCATTCAGGACATGGGCATGG - Intergenic
1013689118 6:112618958-112618980 GAGGATACAGGACAGGAGACTGG + Intergenic
1013704660 6:112817954-112817976 GACCATTCAGGACATAGGCATGG + Intergenic
1013730480 6:113158666-113158688 GAGGAAGCAGGAATTGAGCAAGG + Intergenic
1014358138 6:120437625-120437647 TAGCATTCAGGACATAGGCATGG + Intergenic
1014373151 6:120638564-120638586 TAGCATTCAGGACATAGGCATGG - Intergenic
1014380014 6:120728379-120728401 TAGCATTCAGGACATAGGCATGG + Intergenic
1014480941 6:121935963-121935985 TACCATTCAGGACATGGGCATGG - Intergenic
1014763660 6:125387268-125387290 TACCATTCAGGACATGGGCATGG - Intergenic
1015103654 6:129510726-129510748 GAGGAATCAGCATTTGAGCAAGG + Intronic
1015702750 6:136054129-136054151 TACCATTCAGGACATAAGCATGG - Intronic
1015924548 6:138295990-138296012 GAGGCAATAGGACATGAGCAGGG + Intronic
1016169381 6:140990651-140990673 TAGCATTCAGGACATAGGCATGG - Intergenic
1016638630 6:146323665-146323687 TACCATTCAGGACATGGGCATGG - Intronic
1017372745 6:153732580-153732602 CAGCATTCAGGACATACGCATGG + Intergenic
1017377206 6:153785129-153785151 TAGCATTCAGGACATAGGCATGG + Intergenic
1017999893 6:159569777-159569799 GAGGTTTCATGACATAGGCATGG + Intergenic
1018056011 6:160052999-160053021 TACCATTCAGGACATAAGCATGG + Intronic
1018108979 6:160516986-160517008 TATGATTCAGGACATAGGCATGG + Intergenic
1018139457 6:160814815-160814837 GAGGATGGAGGATTTGAGCAGGG + Intergenic
1018513361 6:164551006-164551028 TACCATTCAGGACATAAGCATGG + Intergenic
1018672017 6:166186884-166186906 TACCATTCAGGACATAAGCATGG + Intergenic
1018721229 6:166574090-166574112 CAGGACTCAGGATAAGAGCAAGG - Intronic
1020364250 7:7363267-7363289 GAGGACTCAGGACTTGAACAAGG - Intronic
1021093670 7:16511349-16511371 GGGGATTCAGGGCCTCAGCACGG + Intronic
1021642433 7:22752395-22752417 TAACATTCAGGACATAAGCATGG - Intergenic
1021754302 7:23836161-23836183 GAGGATGCAAGCCATGAGCTAGG + Intergenic
1021917579 7:25450494-25450516 TACCATTCAGGACATAAGCATGG + Intergenic
1024138909 7:46441512-46441534 TACCATTCAGGACATAAGCATGG - Intergenic
1024514371 7:50232518-50232540 TACCATTCAGGACATAAGCATGG - Intergenic
1025067566 7:55870665-55870687 CACCATTCAGGACATGGGCACGG + Intergenic
1025520635 7:61725139-61725161 TACCATTCAGGACATAAGCATGG + Intergenic
1025544958 7:62153794-62153816 TACCATTCAGGACATAAGCATGG + Intergenic
1025942158 7:66082563-66082585 GAGACCTCAGGACATGAGCCAGG + Intronic
1027896339 7:84050783-84050805 TACCATTCAGGACATAAGCATGG - Intronic
1027897814 7:84067339-84067361 TACCATTCAGGACATAAGCATGG + Intronic
1027922163 7:84407961-84407983 TACCATTCAGGACATAAGCATGG + Intronic
1028800091 7:94953031-94953053 TATGATTCAGGACATAGGCATGG - Intronic
1029489896 7:100865308-100865330 GGGGATTCAGGTCATGAGCTTGG + Intronic
1029817500 7:103111677-103111699 TACCATTCAGGACATGGGCATGG + Intronic
1029855317 7:103509572-103509594 TACCATTCAGGACATAAGCATGG + Intronic
1030257011 7:107521211-107521233 GACCATTCAGGGCATGGGCATGG + Intronic
1030759831 7:113336748-113336770 TAACATTCAGGACATAAGCATGG + Intergenic
1031391623 7:121222029-121222051 TACCATTCAGGACATAAGCATGG - Intronic
1031635329 7:124095164-124095186 TACCATTCAGGACATAAGCATGG - Intergenic
1032704956 7:134413607-134413629 GAGAAATGAGGTCATGAGCATGG + Intergenic
1033079318 7:138279980-138280002 GAGGATTCACGACCTAGGCACGG - Intergenic
1033484074 7:141771030-141771052 TACCATTCAGGACATAAGCACGG - Intronic
1033874021 7:145792510-145792532 GACCATTCAGGACATAGGCATGG + Intergenic
1034141742 7:148825348-148825370 GAGGAGTTAGAACAAGAGCAAGG + Intronic
1034546826 7:151794750-151794772 GATGATTCATGACTTGTGCACGG + Intronic
1034778434 7:153853919-153853941 GACCATTCAGGACATAGGCATGG - Intergenic
1035472858 7:159121198-159121220 GAGGAATCAGAACAGCAGCATGG - Intronic
1035712224 8:1726945-1726967 TACGATTCAGGACATAGGCATGG + Intergenic
1037176930 8:15958352-15958374 GAGGTTGCAGCACATGAGCAAGG - Intergenic
1037252535 8:16913302-16913324 CAGGAGACAGGCCATGAGCAAGG + Intergenic
1037284947 8:17289278-17289300 TACCATTCAGGACATGGGCATGG - Intronic
1037496016 8:19441636-19441658 TACGATTCAGGACATAGGCATGG + Intronic
1037626590 8:20612891-20612913 TACCATTCAGGACATAAGCATGG - Intergenic
1038051705 8:23820230-23820252 GAGGCTTCAGGACATGAACTGGG - Intergenic
1038878390 8:31578370-31578392 TAACATTCAGGACATAAGCATGG - Intergenic
1038926098 8:32141203-32141225 GCTGTTTCAGGACATGACCAAGG + Intronic
1039285272 8:36033103-36033125 TAGCATTCAGGACATAGGCATGG + Intergenic
1039333207 8:36561697-36561719 GAGGCTTCAGGACAGGGCCATGG - Intergenic
1040326797 8:46349684-46349706 TATCATTCAGGACATGGGCATGG - Intergenic
1040429250 8:47322012-47322034 TACCATTCAGGACATGGGCATGG + Intronic
1040437990 8:47411728-47411750 TACCATTCAGGACATGGGCATGG - Intronic
1040784132 8:51145612-51145634 TACCATTCAGGACATAAGCACGG + Intergenic
1040860367 8:51992648-51992670 TACCATTCAGGACATAAGCATGG + Intergenic
1040963319 8:53058617-53058639 TAGCATTCAGGACATAGGCATGG + Intergenic
1041130843 8:54697958-54697980 TACCATTCAGGACATAAGCATGG + Intergenic
1041226876 8:55709071-55709093 GACCATTCAGGACATAGGCATGG + Intronic
1041311555 8:56522673-56522695 GAGGACTAAGGACATGACCAGGG - Intergenic
1041366372 8:57109928-57109950 TACCATTCAGGACATAAGCATGG + Intergenic
1041603448 8:59751222-59751244 TACCATTCAGGACATAAGCATGG + Intergenic
1041743595 8:61182248-61182270 TACCATTCAGGACATGGGCATGG + Intronic
1041837080 8:62228511-62228533 TACCATTCAGGACATGGGCATGG + Intergenic
1041975829 8:63798484-63798506 GACCATTCAGGACATAGGCATGG - Intergenic
1042023377 8:64395862-64395884 GAGGGTTAGGGACTTGAGCATGG + Intergenic
1042025800 8:64422435-64422457 AAAGAAACAGGACATGAGCAGGG - Intergenic
1042207255 8:66341910-66341932 GAGGTTTCAGTCCCTGAGCAAGG - Intergenic
1042441113 8:68828035-68828057 GATGATTCAGGACATGAACTTGG + Intergenic
1042586086 8:70340007-70340029 TACCATTCAGGACATAAGCATGG + Intronic
1042823030 8:72952546-72952568 AAGGAATCAGGAGATGAGCACGG - Intergenic
1042931746 8:74020987-74021009 TATGATTCAGGACATAGGCATGG + Intronic
1042981726 8:74537178-74537200 TATCATTCAGGACATAAGCATGG - Intergenic
1042982424 8:74545366-74545388 AAGGATTCAGGAAATGGGCAGGG - Intergenic
1043253427 8:78104586-78104608 CAGCATTCAGGACATAGGCATGG - Intergenic
1043283715 8:78502769-78502791 TAGCATTCAGGACATAGGCATGG + Intergenic
1043498391 8:80827989-80828011 TACGATTCAGGACATAGGCATGG + Intronic
1043748454 8:83905547-83905569 TAGCATTCAGGACATAGGCAAGG - Intergenic
1043792767 8:84493977-84493999 TAGCATTCAGGACATAGGCATGG - Intronic
1043831814 8:84998327-84998349 TAGCATTCAGGACATAGGCATGG + Intergenic
1044156090 8:88849080-88849102 TAGCATTCAGGACATAGGCATGG + Intergenic
1044349687 8:91149157-91149179 TACCATTCAGGACATGGGCATGG - Intronic
1044521152 8:93200772-93200794 TACCATTCAGGACATAAGCATGG - Intergenic
1044798487 8:95928961-95928983 TACCATTCAGGACATGGGCATGG - Intergenic
1045152688 8:99426987-99427009 GACCATTCAGGACATAGGCATGG - Intronic
1045155096 8:99458993-99459015 TACCATTCAGGACATGGGCATGG - Intronic
1045535527 8:103023448-103023470 GAGGGTTCAGGACTTGGGGAAGG + Intronic
1045587268 8:103552516-103552538 TAGCATTCAGGACATAAGCATGG + Intronic
1045889027 8:107132199-107132221 GAGGGTTGAGGACATTTGCAGGG + Intergenic
1045948491 8:107825160-107825182 TACCATTCAGGACATAAGCATGG - Intergenic
1045997063 8:108375423-108375445 TACCATTCAGGACATAAGCATGG - Intronic
1046318300 8:112536089-112536111 TAGCATTCAGGACATAGGCATGG + Intronic
1046709300 8:117491693-117491715 TACTATTCAGGACATGGGCATGG + Intergenic
1046878787 8:119285394-119285416 TACCATTCAGGACATGGGCATGG - Intergenic
1047051253 8:121116004-121116026 GAGGACTCAGGAGAGGAGGAGGG + Intergenic
1047129770 8:122006144-122006166 TACCATTCAGGACATGGGCATGG + Intergenic
1047763904 8:127974304-127974326 TAGAATTCAGGATATGAGAAAGG - Intergenic
1048092409 8:131255392-131255414 TACCATTCAGGACATGGGCATGG + Intergenic
1048149352 8:131878777-131878799 AACCATTCAGGACATAAGCATGG - Intergenic
1048373156 8:133797867-133797889 TACCATTCAGGACATGGGCATGG + Intergenic
1048577753 8:135706358-135706380 TAGTGGTCAGGACATGAGCAAGG + Intergenic
1048973637 8:139658819-139658841 GCAGACTCAGGACATGGGCAGGG - Intronic
1050181386 9:2926446-2926468 TACCATTCAGGACATAAGCATGG + Intergenic
1050217228 9:3340320-3340342 TACCATTCAGGACATAAGCATGG + Intronic
1050381640 9:5036779-5036801 TACCATTCAGGACATAAGCATGG + Intronic
1050468889 9:5963972-5963994 GACCATTCAGGACATAGGCATGG + Intronic
1050963841 9:11771264-11771286 TACCATTCAGGACATAAGCATGG + Intergenic
1051018247 9:12507855-12507877 TAGCATTCAGGACATAGGCATGG + Intergenic
1051109954 9:13624734-13624756 GAGGCTTCATTACATAAGCATGG - Intergenic
1051299492 9:15633089-15633111 TAGCATTCAGGACATAGGCATGG + Intronic
1051336090 9:16067536-16067558 TACTATTCAGGACATGGGCATGG - Intergenic
1051492182 9:17678705-17678727 TACCATTCAGGACATGGGCATGG - Intronic
1051822608 9:21185248-21185270 TAGCATTCAGGACATTGGCATGG - Intergenic
1051824501 9:21204823-21204845 TAGCATTCAGGACATCGGCATGG - Intergenic
1051827610 9:21237649-21237671 TAGCATTCAGGACATAGGCATGG - Intronic
1051987715 9:23110145-23110167 TACCATTCAGGACATGGGCATGG + Intergenic
1052069791 9:24067988-24068010 CACCATTCAGGACATAAGCATGG + Intergenic
1052280757 9:26730671-26730693 TACCATTCAGGACATGGGCATGG - Intergenic
1052830017 9:33207418-33207440 AAGGGGGCAGGACATGAGCATGG + Intergenic
1052965883 9:34340369-34340391 GAGGAGTGAGGAGATGGGCAGGG + Intronic
1054822384 9:69536368-69536390 GAGGATTAAAGACATGATGATGG + Intronic
1054826181 9:69575774-69575796 TACCATTCAGGACATAAGCATGG + Intronic
1055014469 9:71600896-71600918 TAGCATTCAGGACATAGGCATGG + Intergenic
1055318630 9:75059474-75059496 TACCATTCAGGACATAAGCATGG + Intergenic
1057819471 9:98319894-98319916 TAAGATTCAGGACATAGGCATGG + Intronic
1057844585 9:98513323-98513345 TAAGATTCAGGACATAGGCATGG + Intronic
1058108834 9:101007131-101007153 AATCATTCAGGACATAAGCACGG + Intergenic
1058212279 9:102184077-102184099 TAGCATTCAGGACATATGCATGG - Intergenic
1058430973 9:104919024-104919046 GAGGTTTCTGGCCAGGAGCAGGG - Intronic
1058493514 9:105528698-105528720 TACCATTCAGGACATAAGCATGG + Intronic
1058868063 9:109179870-109179892 GTGGATTCAGGACAGTAGCCTGG - Intronic
1059502311 9:114765790-114765812 GAGGAGTAGGGAGATGAGCAGGG - Intergenic
1060245580 9:121943220-121943242 AAGGTTTCTGGACATGAGCCTGG + Intronic
1062581588 9:137231357-137231379 GAGGGTGCAGGCCATGAGCTGGG - Intronic
1203385220 Un_KI270438v1:44293-44315 TAGCATTCAGGACATAGGCATGG + Intergenic
1203534044 Un_KI270743v1:14095-14117 TACCATTCAGGACATAAGCATGG + Intergenic
1203683302 Un_KI270757v1:8276-8298 GACCATTCAGGACATAGGCATGG + Intergenic
1186693862 X:12007999-12008021 GAGGAAACAGGAAATGGGCAGGG + Intergenic
1187113614 X:16326707-16326729 TAGCATTCAGGACATAGGCATGG + Intergenic
1187222591 X:17343555-17343577 TAGCATTCAGGACATAGGCATGG - Intergenic
1187295969 X:18000921-18000943 AAGGAAGCAGGACAAGAGCATGG + Intergenic
1187414373 X:19080234-19080256 GAGAAATCTGGAGATGAGCAAGG - Intronic
1187436398 X:19274442-19274464 TACCATTCAGGACATAAGCATGG - Intergenic
1188130130 X:26420259-26420281 CATCATTCAGGACATGGGCATGG + Intergenic
1188645106 X:32555887-32555909 TAAGATTCAGGACATAGGCATGG + Intronic
1188848740 X:35105899-35105921 TATCATTCAGGACATAAGCATGG + Intergenic
1189575256 X:42344354-42344376 TACCATTCAGGACATAAGCATGG + Intergenic
1190780728 X:53592444-53592466 GAGGATACAGGGCAAGAGGAAGG - Exonic
1190811954 X:53893456-53893478 TACCATTCAGGACATAAGCATGG + Intergenic
1190900302 X:54665908-54665930 TATGATTCAGGACATAGGCATGG - Intergenic
1191785445 X:64912656-64912678 TACCATTCAGGACATAAGCATGG + Intergenic
1191925611 X:66306585-66306607 TAGCATTCAGGACATAGGCATGG - Intergenic
1192628394 X:72754309-72754331 TACCATTCAGGACATAAGCATGG - Intergenic
1192653314 X:72966501-72966523 TACCATTCAGGACATAAGCATGG + Intergenic
1192721778 X:73706457-73706479 TACCATTCAGGACATAAGCATGG + Intergenic
1192902666 X:75516653-75516675 TACGATTCAGGACATAGGCATGG + Intronic
1192912665 X:75621442-75621464 TACCATTCAGGACATGGGCATGG + Intergenic
1192933518 X:75834339-75834361 TACCATTCAGGACATAAGCATGG - Intergenic
1193157922 X:78193907-78193929 TAGCATTCAGGACATAGGCATGG + Intergenic
1193173904 X:78369457-78369479 TACCATTCAGGACATGGGCATGG - Intergenic
1193228587 X:79015047-79015069 AAGTATTCAGGACATAGGCACGG - Intergenic
1193249958 X:79279276-79279298 TACCATTCAGGACATAAGCATGG + Intergenic
1193595667 X:83441980-83442002 TACCATTCAGGACATAAGCATGG + Intergenic
1193613230 X:83657197-83657219 TACCATTCAGGACATAAGCATGG - Intergenic
1193622824 X:83777662-83777684 TACCATTCAGGACATGTGCATGG - Intergenic
1193623629 X:83789133-83789155 TAGCATTCAGGACATAAGTATGG + Intergenic
1193755379 X:85403088-85403110 TACCATTCAGGACATGGGCATGG - Intergenic
1194209646 X:91056068-91056090 TACCATTCAGGACATGGGCATGG + Intergenic
1194446253 X:93990540-93990562 AACCATTCAGGACATAAGCATGG + Intergenic
1194509772 X:94779465-94779487 TACTATTCAGGACATAAGCATGG + Intergenic
1194664360 X:96661073-96661095 TACCATTCAGGACATGGGCACGG + Intergenic
1194727428 X:97414782-97414804 TACCATTCAGGACATGGGCATGG + Intronic
1195198705 X:102525003-102525025 TACCATTCAGGACATAAGCATGG + Intergenic
1195225859 X:102792485-102792507 TACGATTCAGGACATAGGCATGG - Intergenic
1195444957 X:104941773-104941795 TACCATTCAGGACATGGGCATGG - Intronic
1195733239 X:107987151-107987173 TACCATTCAGGACATGGGCATGG - Intergenic
1195813200 X:108856890-108856912 TATTATTCAGGACATAAGCATGG + Intergenic
1195874506 X:109524667-109524689 TAGCATTCAGGACATAGGCATGG + Intergenic
1195932409 X:110091782-110091804 TAGCATTCAGGACATAGGCATGG - Intronic
1196161211 X:112484965-112484987 TACCATTCAGGACATGGGCATGG - Intergenic
1196168397 X:112560474-112560496 TACGATTCAGGACATAGGCATGG + Intergenic
1196232297 X:113238416-113238438 TACCATTCAGGACATGGGCATGG - Intergenic
1197906735 X:131433326-131433348 TACCATTCAGGACATAAGCATGG + Intergenic
1198043985 X:132881698-132881720 TACCATTCAGGACATAAGCATGG - Intronic
1198294925 X:135277561-135277583 TATGATTCAGGACATAGGCATGG - Intronic
1198556334 X:137797371-137797393 TACCATTCAGGACATAAGCATGG + Intergenic
1198709850 X:139489733-139489755 TAGCATTCAGGACATAGGCATGG + Intergenic
1198711702 X:139510975-139510997 TAGCATTCAGGACATAGGCATGG + Intergenic
1199469372 X:148177215-148177237 TACCATTCAGGACATAAGCATGG - Intergenic
1200693698 Y:6335923-6335945 TACCATTCAGGACATAAGCATGG + Intergenic
1201041579 Y:9838802-9838824 TACCATTCAGGACATAAGCATGG - Intergenic
1201069578 Y:10133126-10133148 TACCATTCAGGACATAAGCATGG - Intergenic
1201070003 Y:10138845-10138867 TACCATTCAGGACATAAGCATGG - Intergenic
1201080423 Y:10239252-10239274 TACCATTCAGGACATGGGCATGG - Intergenic
1201191072 Y:11441726-11441748 GAGGGTTCAGGGCAAGGGCAAGG - Intergenic
1201566782 Y:15373510-15373532 TACCATTCAGGACATAAGCATGG + Intergenic
1201595507 Y:15663863-15663885 TACCATTCAGGACATAAGCATGG - Intergenic
1201644815 Y:16218936-16218958 TATGATTCAGGACATAGGCATGG - Intergenic
1201657999 Y:16366386-16366408 TATGATTCAGGACATAGGCATGG + Intergenic
1201699419 Y:16863827-16863849 TACCATTCAGGACATAAGCATGG + Intergenic
1201960105 Y:19671112-19671134 TACCATTCAGGACATAAGCATGG + Intergenic