ID: 1001235308

View in Genome Browser
Species Human (GRCh38)
Location 5:170024289-170024311
Sequence CTGGATGGTGACAGTGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 378}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001235301_1001235308 -3 Left 1001235301 5:170024269-170024291 CCAGAGCTACATCCTCAACTCTG 0: 1
1: 0
2: 1
3: 20
4: 197
Right 1001235308 5:170024289-170024311 CTGGATGGTGACAGTGTTGGGGG 0: 1
1: 0
2: 3
3: 33
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001235308 Original CRISPR CTGGATGGTGACAGTGTTGG GGG Intronic
900638625 1:3677529-3677551 CTTGATGGTGCCAGGGCTGGGGG + Intronic
900717859 1:4156735-4156757 CAGCCTGGTGACAGTGCTGGGGG - Intergenic
901138896 1:7015195-7015217 CTCCATGGTGACTGTGTTGTTGG + Intronic
901808708 1:11753593-11753615 TTGGATGGGGGCAGTGGTGGGGG + Intronic
902092341 1:13913487-13913509 CTGGATGGTGGGAGAGTTTGGGG + Intergenic
902615437 1:17621047-17621069 CTGGAGGGTTACGGTGATGGTGG + Intronic
903347958 1:22699814-22699836 GTGGATGGTGACGGGGGTGGGGG - Intergenic
903380421 1:22892921-22892943 CTGCACGGTGACCGTGTTGGTGG - Exonic
903578451 1:24353579-24353601 GTGGATGGTGAATGTGTGGGTGG + Intronic
904036822 1:27563549-27563571 CAGGCTGGTGACAGTGATGGGGG - Intronic
904518593 1:31076513-31076535 CTGGATGTTGATAGTGGTGGAGG + Intergenic
904675416 1:32196256-32196278 CTGCATGGAGACAGTGCTGATGG - Exonic
906041092 1:42788245-42788267 CTGGATGGAGGCAGAGCTGGAGG + Intronic
906691063 1:47792969-47792991 CTGGATGGTGAGGGAGTGGGAGG + Intronic
907917685 1:58885885-58885907 TTCAATGGTGACATTGTTGGAGG - Intergenic
909940823 1:81609705-81609727 CTTGATGTTGACAGTGAGGGTGG - Intronic
910599965 1:89020470-89020492 ATGGATGCTGACTGTGTTGGGGG + Intronic
910622267 1:89269305-89269327 CTGGATGGTGACTGTGTGAATGG + Intronic
910964225 1:92791890-92791912 CTATTTGGTGACAGTGTTGATGG - Intronic
911042166 1:93599602-93599624 CTGGATGGGGCCAGGGCTGGAGG + Intronic
911234414 1:95395836-95395858 CTGGGAGCTTACAGTGTTGGAGG + Intergenic
912432575 1:109636803-109636825 CTGGCTGGTGGCAGTGTGGGTGG + Intergenic
912468409 1:109889918-109889940 CTTGGTGGTCACAGTGTTGGAGG + Intergenic
914347754 1:146814516-146814538 CTTGATGTTGACAGGCTTGGTGG - Intergenic
915243567 1:154541172-154541194 CGGGAGGGAGACAGTGCTGGAGG + Intronic
917288572 1:173447449-173447471 CCAGATGTTGACAGTGTGGGAGG + Intergenic
918056773 1:181028365-181028387 GTAGAGGGTGACAGTGGTGGAGG - Intergenic
920067919 1:203282209-203282231 CTGGATGGAGACAAGGTAGGAGG + Intergenic
920147402 1:203873850-203873872 CTGTATCGTGTCAGTGATGGAGG + Intergenic
920365944 1:205448492-205448514 CTGGAGGGAGGCAGTGTGGGTGG - Intronic
921039808 1:211419018-211419040 CTGGATGTTGATAGTGAGGGAGG + Intergenic
921279510 1:213551636-213551658 CTGGATGTTGATAGTGGGGGAGG - Intergenic
921832046 1:219738615-219738637 TGTGATGGTGACAGTGATGGTGG + Intronic
922908252 1:229193017-229193039 CTTGATGGTTTCAGTGTTTGTGG - Intergenic
923455999 1:234166245-234166267 GGGGATGTTGACAGTGTGGGAGG - Intronic
1063012442 10:2037551-2037573 GTTGATGGTGACAGTGATGATGG + Intergenic
1064123870 10:12642453-12642475 GTGGATTGTGTCAGGGTTGGGGG + Intronic
1066043698 10:31578541-31578563 CTGGAGGGTGAGAGTGATTGAGG - Intergenic
1068632066 10:59308495-59308517 GTGGGTGGTGGCAGTGGTGGTGG - Intronic
1069740659 10:70685121-70685143 CAGGCTGGTGAGAGTGATGGGGG + Intronic
1069900680 10:71705107-71705129 ATGGATGGTGAGCGTGCTGGTGG - Intronic
1070569839 10:77632511-77632533 CAGGATGGTTACAGTTTTGATGG - Intronic
1070679977 10:78442095-78442117 CTGGATGGTGAAGGGGATGGAGG + Intergenic
1071532464 10:86400616-86400638 CTGGAAGGTGAGGGTGTGGGAGG - Intergenic
1071795256 10:88998113-88998135 CTGGGTGGCTACAGTTTTGGGGG + Intronic
1072341180 10:94452221-94452243 CAGGATGCTGACAGTGAAGGAGG - Intronic
1072581344 10:96742415-96742437 CTGGATATGGACTGTGTTGGTGG + Intergenic
1073921220 10:108462177-108462199 ATGGATGTTGACAGTGGGGGAGG - Intergenic
1074522515 10:114238386-114238408 CTGGAAGCTGTCAGTGTCGGAGG + Intergenic
1075087545 10:119423570-119423592 CGGGTTGGTGGCAGTGGTGGGGG - Intronic
1075219986 10:120576426-120576448 ATGGATGGGGACAGGGTTGAGGG + Intronic
1075733512 10:124650373-124650395 CTGGATGATGACAATGATGGTGG + Intronic
1075789885 10:125076462-125076484 CTGAGTGGTGACAGTGTTCCTGG - Intronic
1076671503 10:132123186-132123208 CTGGATGGTGACAGGCTCTGAGG + Intronic
1076715971 10:132363875-132363897 CTGGAGGCTGACAGTGTTTAGGG + Intronic
1077417316 11:2430646-2430668 AGTGATGGTGACAGTGTTGATGG + Intergenic
1078076036 11:8161682-8161704 CTGGAAGGTGAGAGTGATGGAGG + Intronic
1079123468 11:17701526-17701548 CAGGATGTTGACAGTGGGGGAGG - Intergenic
1079214674 11:18498055-18498077 CTGGATGTTGAGTGTGTGGGTGG + Intronic
1079765786 11:24390441-24390463 ATGAATGGTAACAGTGCTGGTGG - Intergenic
1079883759 11:25959261-25959283 CTGGAAGGTTACAGTCATGGTGG - Intergenic
1080202520 11:29689463-29689485 TTGGATGGTGACAGAGAGGGAGG - Intergenic
1080696785 11:34609673-34609695 CTAGTTGGGGGCAGTGTTGGGGG + Intergenic
1081984243 11:47290045-47290067 CCGGATGTGGTCAGTGTTGGGGG + Exonic
1083621460 11:64051408-64051430 CTCAGTGGTGACAGTGATGGCGG + Intronic
1083748564 11:64748262-64748284 CAGGATGGAGACAGTGCTGGAGG - Intronic
1084048269 11:66583510-66583532 CTGGCTGGAGCCAGTGTTGTGGG - Intergenic
1084444300 11:69194577-69194599 GTTGATGGTGATAGTGTTGATGG + Intergenic
1084465897 11:69322895-69322917 GTGGATGGTGATGGTGGTGGCGG + Intronic
1084714152 11:70863117-70863139 CTGGAATGTGACAGTGTTCACGG - Intronic
1085152319 11:74262164-74262186 CTGCGTGGTGACAGTGTTTTTGG - Intronic
1085403768 11:76249774-76249796 CTTGAAGGTGCCAGTGATGGTGG + Intergenic
1085914441 11:80868324-80868346 CTGGGTGGTGAAGGTGTTGGTGG - Intergenic
1086124772 11:83339072-83339094 CTGGTTGGTGGCAGGGGTGGGGG + Intergenic
1086834202 11:91600969-91600991 CTGGATGGTCAGAGACTTGGAGG + Intergenic
1087063935 11:94010010-94010032 CAGGATGGTGGCCTTGTTGGCGG + Intergenic
1087796762 11:102462179-102462201 CAGTCTGGTGACAGTTTTGGTGG - Intronic
1088110857 11:106259829-106259851 CAGGATTGTGACAATGTGGGTGG - Intergenic
1089133991 11:116234871-116234893 CTGGATGGTCACAGTGCTATGGG - Intergenic
1090449929 11:126797372-126797394 CTGGATGCTGATAGTTTTGGTGG + Intronic
1091337738 11:134785227-134785249 CTGGATGGTGTCACTATCGGGGG + Intergenic
1092305753 12:7299044-7299066 CTTGTTGGTGACAGTGATGGTGG - Intergenic
1092535096 12:9379594-9379616 GTGGCTGGTGTAAGTGTTGGTGG + Intergenic
1093220314 12:16413054-16413076 CTGGATGGTGATAGTGAAGGTGG + Intronic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1095325773 12:40890276-40890298 CGGGATGTTGACAGTGGGGGAGG - Intronic
1096838025 12:54363525-54363547 CAGGATGGAGACAGAATTGGAGG + Exonic
1097256515 12:57679914-57679936 CAGGATGTTGACAGTGGGGGAGG + Intergenic
1097668243 12:62506019-62506041 ATGGTTGGTGATAGTGCTGGAGG + Intronic
1098357526 12:69625766-69625788 CTTGATGTTGTCAGTGTTTGGGG + Intergenic
1100783771 12:98057458-98057480 CCCTAAGGTGACAGTGTTGGGGG - Intergenic
1101770774 12:107748738-107748760 TTGGAAGGAGACAGTGGTGGTGG + Intronic
1101810632 12:108104594-108104616 CTCGATGGTGATAGAGTTGGAGG - Intergenic
1102399399 12:112615445-112615467 CTCCATGGTAACAGTTTTGGGGG + Intronic
1103140779 12:118546154-118546176 ATGGATGGTGGCAGTGGTGGAGG + Intergenic
1103147441 12:118607857-118607879 CTGGTTTGTGAAAGTGGTGGTGG - Intergenic
1104939923 12:132390228-132390250 CTGGCAGGTGACAGGGTGGGCGG + Intergenic
1105419792 13:20241928-20241950 CTGGATGGTGCCAGGTTTGGAGG + Intergenic
1105822018 13:24088222-24088244 CTGGATGCCCACAGTGTTTGAGG + Intronic
1105898544 13:24738654-24738676 CAGGATGGCGACAGTGTTAGGGG + Intergenic
1106329449 13:28726041-28726063 GTTGGTGGTGACAGTGGTGGTGG + Intergenic
1106638681 13:31559573-31559595 CTTGATGGTGGCAGAGTTGGGGG + Intergenic
1107044595 13:35981419-35981441 CTGGATGTTGATAGTGGGGGAGG - Intronic
1108277045 13:48821383-48821405 CTGAATGGTGAAATTGTTGCTGG + Intergenic
1108609641 13:52071533-52071555 CTGGCTGGGGCCAGTGTTGTGGG - Intronic
1109406711 13:61909720-61909742 CAGGCTGGTGACACTTTTGGTGG + Intergenic
1109515522 13:63438963-63438985 CTGGCTGGGGACAGTGCTGCTGG + Intergenic
1112497883 13:99919212-99919234 CTGGAAGGTGACAGTATTTTGGG - Intergenic
1112594438 13:100795105-100795127 ATGGATGGGGCCAGTGTGGGAGG - Intergenic
1113061096 13:106323356-106323378 CTGGGTCATGATAGTGTTGGTGG - Intergenic
1113182885 13:107651672-107651694 CTGGAAGGTGAAGGTGTGGGTGG - Intronic
1113405119 13:110031713-110031735 CTAGAAGAGGACAGTGTTGGAGG + Intergenic
1113447881 13:110384518-110384540 CTGGACGGTGGCCTTGTTGGAGG - Intronic
1113489768 13:110682097-110682119 GGGGATGCTGACAGTGTGGGGGG + Intronic
1113577560 13:111404863-111404885 CTGGCTGGTGAGAGTGTCAGTGG + Intergenic
1113768550 13:112894933-112894955 GTGGCTGGGGACAGTGCTGGAGG + Intronic
1113930520 13:113966257-113966279 GATGATGGTGACAGTGATGGTGG + Intergenic
1113967637 13:114163446-114163468 GTGAATGGAGACTGTGTTGGAGG - Intergenic
1114301902 14:21385831-21385853 CTGGATGGTGATGGTGGTGATGG + Exonic
1114364443 14:22012002-22012024 CTGAATGGCGCCAGTGGTGGGGG + Intergenic
1116816173 14:49585783-49585805 GTAGCTGGTGACAGTGTTGATGG - Intronic
1116904619 14:50392684-50392706 CAGGTTGGAGACAGAGTTGGGGG - Intronic
1119542732 14:75451298-75451320 CTGGAAAGTGACAGTGGGGGTGG + Intronic
1119787784 14:77325952-77325974 CTGGGGAGTGACAGTGTTTGGGG - Intronic
1122286533 14:100655732-100655754 CTGGATGGTGACTTTTTGGGGGG + Intergenic
1122783083 14:104151929-104151951 ATGGACGGTGAGAGTGCTGGTGG + Intronic
1123184806 14:106506486-106506508 CAGGATGGTGACAGTGGGGAAGG + Intergenic
1123399705 15:19972278-19972300 CAGGATGGTGACAGTGGGGAAGG + Intergenic
1124692591 15:31838365-31838387 CTGGATGATGGCAGTGCTAGTGG - Intronic
1125766316 15:42138887-42138909 CCTGAAGGTGACAGAGTTGGAGG - Intergenic
1125766408 15:42139547-42139569 CCTGAAGGTGACAGAGTTGGAGG - Exonic
1126697930 15:51341534-51341556 CGGGATGGGGACAGTAGTGGTGG - Intergenic
1127484537 15:59407144-59407166 CTGTGTGGTGACAGTGGTGCAGG + Intronic
1128282629 15:66409046-66409068 CAGGAGGGTCACAGTGTTGTTGG + Intronic
1128387875 15:67163553-67163575 CTGGATGATGAGAGTCTGGGTGG - Intronic
1128626044 15:69205086-69205108 CTGGATATTGACTGTGATGGTGG - Intronic
1128934935 15:71738134-71738156 ATGGATGGTGGCGGGGTTGGGGG + Intronic
1129108956 15:73326454-73326476 CTGGCTGGTTACAGAGATGGAGG + Intronic
1129239886 15:74244933-74244955 CTGAATGGTGCCAGTATTGGTGG - Intronic
1129534649 15:76302734-76302756 CTGTATGTTGACAGTGGAGGAGG + Intronic
1131558673 15:93420665-93420687 CTGGCAGGTGACAGGGTTGGAGG + Intergenic
1132116205 15:99138170-99138192 CTGGATGGGAACGGTGTGGGGGG - Intronic
1132814229 16:1818270-1818292 CTGGGTGGTGCCGGTGTGGGAGG - Intronic
1133267073 16:4591753-4591775 CTGGATCCTGACAGTGCTGCTGG + Exonic
1133323627 16:4930347-4930369 CTGGATGGGGACAGGGCAGGGGG + Intronic
1134239596 16:12495705-12495727 CTGGATGGGGTCAGTGTGGCTGG + Intronic
1134425212 16:14135816-14135838 CTGGATGGGGCCAGTGTAGAGGG - Intronic
1134482217 16:14629888-14629910 CCGGATGGTGCCGGGGTTGGAGG + Intronic
1135576726 16:23591696-23591718 CTGGAAGGGAACATTGTTGGGGG - Intronic
1136093011 16:27934156-27934178 CTGGAGGGTAGTAGTGTTGGCGG - Intronic
1136576937 16:31130669-31130691 CAGGATGGTGACAGGGTATGAGG - Intronic
1139986284 16:70901022-70901044 CTTGATGTTGACAGGCTTGGTGG + Exonic
1140475204 16:75236424-75236446 CTGGGTGGTAACAGTGATGGTGG - Intronic
1140898096 16:79343052-79343074 CTAGCTGGAGACTGTGTTGGAGG + Intergenic
1141449967 16:84092568-84092590 CTGGACGGGGACAGGGGTGGGGG + Intronic
1141880077 16:86852119-86852141 AGTGATGGTGACAGTGATGGTGG - Intergenic
1141880082 16:86852161-86852183 AGTGATGGTGACAGTGATGGTGG - Intergenic
1142065639 16:88060863-88060885 CTGGATGGTGAGAGGGAGGGTGG - Intronic
1142121092 16:88387088-88387110 CTGGGTGGACACAGTCTTGGAGG - Intergenic
1142332851 16:89466398-89466420 CTGGAATGTGACAGTGGTGATGG + Intronic
1142849138 17:2695905-2695927 CTGGATGGTGGCATGGCTGGGGG - Intronic
1143476503 17:7206439-7206461 GTGGAGGGAGAGAGTGTTGGAGG - Intronic
1143982291 17:10880347-10880369 CTGGTTGGTGAGGGTGTTGGTGG + Intergenic
1144003180 17:11074408-11074430 CTGTCTGGTGACAGAATTGGTGG - Intergenic
1146359342 17:32160975-32160997 CTGGGTGGTGTCAGTGTTACGGG - Intronic
1146843234 17:36168810-36168832 TGGGAAGGTGACAGTGTTGTGGG - Intronic
1146855544 17:36256751-36256773 TGGGAAGGTGACAGTGTTGTGGG - Intronic
1146865077 17:36331624-36331646 TGGGAAGGTGACAGTGTTGTGGG + Intronic
1146871450 17:36380662-36380684 TGGGAAGGTGACAGTGTTGTGGG - Intronic
1146878809 17:36431744-36431766 TGGGAAGGTGACAGTGTTGTGGG - Intronic
1146882753 17:36452890-36452912 TGGGAAGGTGACAGTGTTGTGGG - Intergenic
1147067936 17:37932218-37932240 TGGGAAGGTGACAGTGTTGTGGG + Intronic
1147074336 17:37981286-37981308 TGGGAAGGTGACAGTGTTGTGGG - Intronic
1147079467 17:38011773-38011795 TGGGAAGGTGACAGTGTTGTGGG + Intronic
1147085858 17:38060824-38060846 TGGGAAGGTGACAGTGTTGTGGG - Intronic
1147095408 17:38135715-38135737 TGGGAAGGTGACAGTGTTGTGGG + Intergenic
1147101805 17:38184790-38184812 TGGGAAGGTGACAGTGTTGTGGG - Intergenic
1147333847 17:39715294-39715316 CTGGAGCGGGGCAGTGTTGGAGG - Exonic
1148271838 17:46267369-46267391 CTGGCTGGTGACCCTGCTGGTGG + Intergenic
1148864474 17:50621328-50621350 CTGGGTGGTGGTAGTGTGGGAGG + Intronic
1149846398 17:60011300-60011322 TGGGAAGGTGACAGTGTTGTGGG - Intergenic
1150084748 17:62267875-62267897 TGGGAAGGTGACAGTGTTGTGGG - Intergenic
1150106326 17:62465026-62465048 CTGGATGCTGGAAGTGTGGGTGG + Intronic
1151498626 17:74474634-74474656 CTGGATGCTGGCACTGTGGGTGG - Exonic
1151534141 17:74729262-74729284 CTGGTGGGTGACAGTGGTGTGGG + Intronic
1151704228 17:75758245-75758267 CTGCACGGTGACACTGCTGGAGG - Exonic
1151850487 17:76686940-76686962 GAGGCTGGTGACAGTGCTGGGGG + Intronic
1151886606 17:76926503-76926525 CTGGCTGGTGACAGTGCTCGTGG + Intronic
1152177954 17:78800275-78800297 CTGGATGGCCACAGGGGTGGAGG + Intronic
1152298876 17:79484133-79484155 CTGGGTGGTGCCAGTGGTGGGGG - Intronic
1152511394 17:80791905-80791927 CTGGATGGCGACAGGGGGGGAGG - Intronic
1153317644 18:3740748-3740770 AGTGATGGTGACAGTGGTGGTGG - Intronic
1153597395 18:6741779-6741801 CTGGATGTGGGCAGGGTTGGGGG - Intronic
1155426000 18:25708298-25708320 CTTGATAATGACAGTGTTTGGGG - Intergenic
1155726829 18:29096569-29096591 GTGGATGGAGATAGTGTTGGTGG + Intergenic
1155872024 18:31041868-31041890 GTAGAGGGTGACAGTGGTGGGGG - Intronic
1156027347 18:32669995-32670017 GTGGGTGGTACCAGTGTTGGTGG + Intergenic
1156262490 18:35458550-35458572 GTGGGTGGTGGCAGTGGTGGTGG + Intronic
1156742338 18:40347147-40347169 CTGCCTGGTGACTGTGTTGATGG + Intergenic
1156804128 18:41156055-41156077 CTGCATTGTGACAGGGGTGGTGG + Intergenic
1157590014 18:48830761-48830783 CAGGCTGGGGACAGTGGTGGGGG - Intronic
1158562736 18:58528903-58528925 CTGGATGGGGAAAATGATGGAGG - Intronic
1160420222 18:78738864-78738886 CTGTATGGGGACTGTGTGGGGGG - Intergenic
1160505206 18:79423000-79423022 AGGGGTGGGGACAGTGTTGGGGG + Intronic
1160860271 19:1234652-1234674 GTGGATGGTGACAATCTTGAGGG + Exonic
1161590387 19:5126768-5126790 CGGGAGGGTGGCAGTGTTGAAGG + Intronic
1162049106 19:8021525-8021547 CTGGATGAGGTCAGAGTTGGAGG + Intronic
1162685132 19:12376581-12376603 CTGGGTGGTGACAAGGTGGGAGG + Intergenic
1163827667 19:19532756-19532778 CTGGTTGGGGTCAGGGTTGGGGG - Intronic
1164815174 19:31193400-31193422 CTGGATGGTGGCTGTCTTGATGG + Intergenic
1165793279 19:38504993-38505015 CGGGATGATCACACTGTTGGGGG - Exonic
1166757214 19:45200692-45200714 CTGGATGGTGTCAATGCTTGTGG + Intronic
1167499588 19:49837610-49837632 CTGGGTGGTGGCGGTGTCGGGGG + Intronic
1168115001 19:54217478-54217500 CTGGAGAGAGACAGTGGTGGGGG + Intronic
1168120693 19:54251170-54251192 CTGGAGAGAGACAGTGGTGGGGG + Intronic
1168124271 19:54275067-54275089 CTGGAGAGAGACAGTGGTGGGGG + Intronic
1168177715 19:54636471-54636493 CTGGAGAGAGACAGTGGTGGGGG - Intronic
1168181987 19:54667612-54667634 CTGGAGAGAGACAGTGGTGGGGG - Intronic
1168322758 19:55519806-55519828 ATTGATGGTGACGGTGATGGTGG + Intergenic
926718527 2:15942381-15942403 CTGGAGGATGACCGGGTTGGGGG - Exonic
927066123 2:19472738-19472760 GATGATGGTGAGAGTGTTGGGGG - Intergenic
927521444 2:23701132-23701154 GTGGATGGTGACACTACTGGTGG - Intronic
927553950 2:24019803-24019825 CTAGAGGGTGCCAGTGCTGGAGG - Intronic
927649459 2:24903176-24903198 ATGGATGTTGACTGTGTGGGGGG + Intronic
929248801 2:39730590-39730612 CAGGCTGGTGGCAGTATTGGTGG + Intergenic
929812301 2:45200941-45200963 CTGGATGGTGGCAGCAATGGTGG - Intergenic
932456523 2:71852945-71852967 CTGGATGGGCACAGGGCTGGGGG - Intergenic
936400409 2:112160312-112160334 CTGGTTGGTGGCAGTGGGGGTGG + Intronic
938381985 2:130841776-130841798 CTGAAGGGATACAGTGTTGGTGG - Intronic
938683048 2:133711618-133711640 CCAGATGGTGACAGGGTTGAAGG + Intergenic
939957815 2:148541254-148541276 CTGGGTGGTGGCAGCGATGGTGG + Intergenic
942460234 2:176163360-176163382 CTGAGCGGTGACAGTGGTGGGGG + Intronic
942604587 2:177676981-177677003 ATGGATGCTGACAGTACTGGAGG + Intronic
943425525 2:187728279-187728301 TAGGATGGTCACAGTCTTGGAGG + Intergenic
943564871 2:189505545-189505567 CTGGAAGGTGAATGTGTTGTTGG + Intergenic
944080940 2:195787828-195787850 CTGGATGGGCCCACTGTTGGAGG - Intronic
946034808 2:216733216-216733238 CAAGATGGTGAGAGTGTGGGAGG + Intergenic
947185819 2:227454416-227454438 CTGGAGGGTGAGAGGGATGGAGG + Intergenic
948797843 2:240413746-240413768 GTGCAAGGTGTCAGTGTTGGCGG + Intergenic
1170943926 20:20872620-20872642 CTGAATGGTCACATGGTTGGAGG + Intergenic
1171283522 20:23920296-23920318 CTTGTGGGTGACAGTGTGGGCGG - Intergenic
1171878652 20:30600314-30600336 CTGGATGGTGGCATGGTTGGAGG - Intergenic
1173009047 20:39164754-39164776 CTGGAAGGTGACTGCGCTGGAGG - Intergenic
1174560387 20:51426805-51426827 CTGGATTATGACAGTCTTGTTGG - Intronic
1175328750 20:58148205-58148227 CTTGAGGATGACAGTGTTGAAGG - Intergenic
1176703158 21:10083265-10083287 CTGGTTGGTGACTGTAGTGGGGG - Intergenic
1177518730 21:22189437-22189459 CAGAATGTTGACAGCGTTGGAGG - Intergenic
1179049261 21:37874843-37874865 CAGGAGGGTGGCAGTGGTGGAGG - Intronic
1179500507 21:41805909-41805931 GATGGTGGTGACAGTGTTGGTGG - Intronic
1182077366 22:27504313-27504335 TTGGATGGTGAGGGTATTGGAGG + Intergenic
1182220918 22:28758057-28758079 ATGGATGGGGACGGTGCTGGAGG - Intergenic
1182621518 22:31621169-31621191 CTGGGTGCTCACTGTGTTGGTGG - Intronic
1183037430 22:35150798-35150820 ATGGCTGGGGACAGTGATGGTGG - Intergenic
1183052757 22:35277788-35277810 GGGGATGGTGACAGTGTGGAAGG - Intronic
1183367906 22:37416946-37416968 CTGGCTGCGCACAGTGTTGGTGG - Intronic
950101673 3:10360836-10360858 CTGAATCTTGACAGTGGTGGTGG - Intronic
951465082 3:22992084-22992106 CAAGATGGGGACAGGGTTGGGGG - Intergenic
952897465 3:38087285-38087307 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897467 3:38087304-38087326 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897471 3:38087344-38087366 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897473 3:38087363-38087385 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897477 3:38087403-38087425 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897483 3:38087462-38087484 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897487 3:38087502-38087524 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897489 3:38087521-38087543 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897493 3:38087561-38087583 ATGGATGGTGTCAGTGCTGATGG - Intronic
952897497 3:38087601-38087623 ATGGATGGTGTCAGTGCTGATGG - Intronic
953415656 3:42714672-42714694 CTTGAAACTGACAGTGTTGGAGG + Intronic
954189306 3:48945194-48945216 AGGGCTGGTGACAGTTTTGGTGG + Intronic
955228972 3:57082460-57082482 CTGGATGGTGTGATTGTGGGTGG - Intergenic
957017820 3:75090432-75090454 CAGCATAGTGACAGTGTTGTGGG - Intergenic
958068891 3:88583523-88583545 GTTGGTGGTGACAGTGGTGGTGG + Intergenic
958104458 3:89054330-89054352 CTGTGTGTTGACAGTGGTGGGGG + Intergenic
958684505 3:97375900-97375922 ATGTATGGGGACAGTGGTGGAGG + Intronic
958734052 3:97989195-97989217 GTGGATGGTGGTGGTGTTGGTGG + Intronic
959965562 3:112350248-112350270 CATGATGCTGACAGTGTTTGAGG - Intronic
960263788 3:115597635-115597657 CTGGTTGGTTAGAGTGTCGGTGG - Intergenic
961508491 3:127387415-127387437 TTGGGTGGTGACACTGGTGGGGG - Intergenic
962289616 3:134123134-134123156 GTGGGTGGTGACAGTAGTGGTGG + Intronic
965217853 3:165887212-165887234 CTGTTTGTTGACAGTGTTGATGG + Intergenic
965807629 3:172558517-172558539 CTGGATGGGGTGAGGGTTGGAGG + Intergenic
966734293 3:183176672-183176694 CAGGATGCTGACAGTGGGGGTGG - Intergenic
967444902 3:189555130-189555152 CTGGGTTGTGACAGTGCTAGAGG + Intergenic
967805024 3:193708174-193708196 CAAGATGGTGACAGTGTGGACGG - Intergenic
967844428 3:194032722-194032744 CTGGAGGCTGAGGGTGTTGGGGG + Intergenic
969372598 4:6743299-6743321 TTTGGTGGTGACAGTGTTGATGG - Intergenic
969709621 4:8835257-8835279 CTGGATGGCAGCAGTGGTGGTGG - Intergenic
972237838 4:37154556-37154578 CTTGATTGTGACGGTGGTGGTGG - Intergenic
972745913 4:41932699-41932721 CTGGATTGAGGCAGTGTTGTTGG - Intergenic
975149492 4:71005224-71005246 CTGGAAGGTGAAAGGGGTGGGGG - Intronic
976049748 4:80997847-80997869 CTGGATGGTGCCAATATTGAGGG + Intergenic
978525802 4:109663925-109663947 GTGGCAGGTGACAGTTTTGGGGG - Intronic
979095849 4:116550143-116550165 CTGCCTAGTGGCAGTGTTGGTGG - Intergenic
980375361 4:131939633-131939655 CTGGTTGGTGACTGTAATGGGGG - Intergenic
981566323 4:146105304-146105326 GTGGATGGAGACAGGGTAGGAGG - Intergenic
982108602 4:152032841-152032863 ATGGAGAGTGACAGTGATGGGGG + Intergenic
983512083 4:168619667-168619689 CTGGAGGAAGACAGTGATGGGGG + Intronic
984395870 4:179199302-179199324 CTGGATTTTGACAGTGTGTGTGG - Intergenic
984879425 4:184397630-184397652 CTGGTCGGAGCCAGTGTTGGGGG + Intronic
985838248 5:2286592-2286614 ATGGATGTTGATAGTGGTGGTGG - Intergenic
988696355 5:33626254-33626276 CAGGATGGTGGTAGTGGTGGGGG + Intronic
990950243 5:61291477-61291499 CAGAACGGTGACAGTGCTGGAGG + Intergenic
991967510 5:72107528-72107550 CAGGATGGCGACCGTGGTGGTGG + Exonic
992376530 5:76193333-76193355 GTGGATGGTGATAGTCTAGGGGG + Intronic
996683756 5:126257341-126257363 CTGGAAGGTGCCAATGGTGGTGG - Intergenic
999120209 5:149203740-149203762 GTTGGTGTTGACAGTGTTGGTGG - Intronic
999144554 5:149383660-149383682 CTGGACGGGAACATTGTTGGTGG + Intronic
1001235308 5:170024289-170024311 CTGGATGGTGACAGTGTTGGGGG + Intronic
1002054769 5:176592440-176592462 ATGGATGATGACGGTGGTGGTGG + Intronic
1003102114 6:3184646-3184668 CTGGATGGCCACAGGGTTGCCGG + Intergenic
1003521404 6:6861576-6861598 CTGGATGGTTTCAGTGATGGAGG - Intergenic
1005019494 6:21404106-21404128 CTGAGAGGAGACAGTGTTGGGGG + Intergenic
1005199540 6:23327573-23327595 CAAGATGGTGATAGTGATGGTGG - Intergenic
1006335586 6:33418885-33418907 CAGGATGGGGACAGTGGTGATGG + Intergenic
1007170234 6:39857514-39857536 CTGGATGGGGCAAGTGGTGGGGG + Intronic
1007877916 6:45127357-45127379 CTGTATGATGACAGTGTATGAGG - Intronic
1008681262 6:53875517-53875539 CTAGGTGATGAGAGTGTTGGTGG + Intronic
1008985455 6:57536903-57536925 CTGCATGTTGACTGTGGTGGTGG + Intronic
1012909363 6:105102055-105102077 ATGGATCCTGACAGTGATGGTGG - Intronic
1013232984 6:108174130-108174152 CTGGAAGGTGAGAGTTTAGGAGG - Intronic
1013454991 6:110322550-110322572 CAGGTTGGTGACACTCTTGGAGG + Intronic
1014143895 6:117974007-117974029 CTGGATGGTGCCAGTTTTACTGG + Intronic
1014677295 6:124383079-124383101 ATGAATGGTGACACTATTGGAGG - Intronic
1015824611 6:137298383-137298405 TTGGATGGTAACAGTGAGGGAGG - Intergenic
1017509411 6:155100532-155100554 ATGGGAGGTGACAGTGATGGTGG - Intronic
1017937886 6:159023104-159023126 AAAGATGGTGGCAGTGTTGGTGG + Intergenic
1018793938 6:167171650-167171672 GTGGATGGTGACAGTGTGTTAGG + Intronic
1018793955 6:167171757-167171779 GTGGATGGTGACAGTGTGTTAGG + Intronic
1018793972 6:167171864-167171886 GTGGATGGTGACAGTGTGTTAGG + Intronic
1018822364 6:167383214-167383236 GTGGATGGTGACAGTGTGTAAGG - Intronic
1018822394 6:167383430-167383452 GTGGATGGTGACAGTGTGTTAGG - Intronic
1019286593 7:226320-226342 CTGGAGGGTCACAGTGCAGGGGG + Intronic
1019391163 7:787416-787438 CTGGGGGGTGTCAGGGTTGGGGG + Intergenic
1019450876 7:1097212-1097234 CTGGAGGGTGGCAGTGTTCGGGG - Intronic
1019711715 7:2520998-2521020 CGGGATGGGGACAGTGTGTGGGG + Intronic
1019765907 7:2850070-2850092 GATGATGGTGACAGTGATGGTGG - Intergenic
1019765949 7:2850420-2850442 GATGATGGTGACAGTGATGGTGG - Intergenic
1021284919 7:18769409-18769431 CTGGATGGTGGCAGCAGTGGTGG + Intronic
1023229699 7:38013531-38013553 GTGGACGGTGACAGGGTTTGAGG - Intronic
1023615109 7:42011824-42011846 CTGGAAGTGGACAGTGTTGGCGG + Intronic
1024230959 7:47363048-47363070 GTGGATGATGACGGTGATGGTGG - Intronic
1024982187 7:55166822-55166844 CACAATGGTGGCAGTGTTGGTGG + Intronic
1025014247 7:55426091-55426113 CTGAATTGTGACATTCTTGGAGG + Intronic
1028761660 7:94504002-94504024 TTGGATGGTGCCTGTGTTGAAGG + Intergenic
1030391603 7:108934738-108934760 TGGGATGATGACAGTGGTGGTGG + Intergenic
1030723951 7:112902691-112902713 CTGGATGTTGACAGTGGGGGAGG + Intronic
1032453685 7:132055991-132056013 CTGGCTGGTGCCTGGGTTGGTGG - Intergenic
1032484544 7:132275420-132275442 CTGGATGTTGATTGTGGTGGTGG - Intronic
1032501669 7:132404414-132404436 CTGGTTGGTGACAGTGGTGGAGG - Intronic
1033363589 7:140655096-140655118 GTGGGTGGTAACAGTGGTGGTGG - Intronic
1034637187 7:152576718-152576740 CTGGAGGGTCACAGTGGAGGTGG - Intergenic
1034929905 7:155153453-155153475 AGGGCTGGTGACAGTGTTGTAGG - Intergenic
1035405435 7:158594083-158594105 GTTGAAGGTGTCAGTGTTGGTGG + Intergenic
1036046132 8:5142694-5142716 CTTGATGGTGCCAGTCATGGAGG - Intergenic
1036560381 8:9896734-9896756 GTGGGTGGTGACTGTGGTGGAGG - Intergenic
1038419032 8:27420305-27420327 CGGGATGCTGACAGTGCTAGGGG + Intronic
1043566320 8:81552499-81552521 CTGGATGGCAAGAGAGTTGGAGG + Intergenic
1044096977 8:88078940-88078962 TCGGATGGTGACAGTGGTGATGG - Intronic
1045843849 8:106610196-106610218 TTGGATTGTAGCAGTGTTGGTGG - Intronic
1045870852 8:106925250-106925272 CTGGATGCTCACAGTGCTGCTGG + Intergenic
1046411450 8:113848740-113848762 CTAGATGGGGAGAGTGGTGGTGG - Intergenic
1047506496 8:125484783-125484805 ATGGATGGGGAAAGTGTTAGCGG + Intergenic
1048468243 8:134685162-134685184 GGGGATGGTGACGGTGGTGGTGG - Intronic
1049113437 8:140664756-140664778 CTGGTTGGGGCCAGTGTTAGAGG + Intronic
1049274666 8:141713942-141713964 GGTGATGGTGACAGTGGTGGGGG + Intergenic
1049307197 8:141910373-141910395 GTGGATGATGACAGTGTGTGAGG + Intergenic
1049369183 8:142255425-142255447 GGTGATGGTGACAGTGGTGGTGG - Intronic
1049369197 8:142255497-142255519 GGTGATGGTGACAGTGGTGGTGG - Intronic
1049369217 8:142255584-142255606 GGTGATGGTGACAGTGGTGGTGG - Intronic
1049369249 8:142255731-142255753 GGTGATGGTGACAGTGGTGGTGG - Intronic
1049369264 8:142255803-142255825 GGTGATGGTGACAGTGGTGGTGG - Intronic
1049369284 8:142255890-142255912 GGTGATGGTGACAGTGGTGGTGG - Intronic
1049369336 8:142256142-142256164 GGTGATGGTGACAGTGGTGGTGG - Intronic
1049369347 8:142256196-142256218 GGTGATGGTGACAGTGGTGGTGG - Intronic
1049402002 8:142432324-142432346 GTTGATGGTGATAGTGATGGTGG - Intergenic
1049431104 8:142565463-142565485 CTGGCTGGTGACAGTGACAGCGG - Intergenic
1050427550 9:5527250-5527272 CTGGATGTTCACTGTGGTGGTGG - Intronic
1051367084 9:16328883-16328905 CTGGATAGTGCCATTTTTGGAGG + Intergenic
1052503008 9:29316979-29317001 TTGGATGACGACTGTGTTGGAGG + Intergenic
1052505161 9:29343991-29344013 CTATATGCTTACAGTGTTGGAGG - Intergenic
1053168692 9:35862899-35862921 CTGGAGGGTGACAGTGATGAAGG - Intergenic
1053435902 9:38074309-38074331 CAGGATGGTAACAGTGGAGGGGG - Intergenic
1053640416 9:40070297-40070319 CTGGTTGGTGACTGTAATGGGGG - Intergenic
1053765722 9:41395177-41395199 CTGGTTGGTGACTGTAATGGGGG + Intergenic
1054321110 9:63666292-63666314 CTGGTTGGTGACTGTAATGGGGG - Intergenic
1054544333 9:66306330-66306352 CTGGTTGGTGACTGTAATGGGGG + Intergenic
1055403111 9:75945444-75945466 CAGGATGGTGGCAGTGCAGGGGG - Intronic
1056762957 9:89427869-89427891 CTGGAAGGTGACTGTGTGGGGGG - Intronic
1056763314 9:89429388-89429410 AGGGATGGTGACAGTGTTGCTGG - Intronic
1057265545 9:93615054-93615076 GATGATGGTGACAGTGATGGTGG + Intronic
1059505983 9:114800299-114800321 CTGGATGGAGGGAGGGTTGGAGG - Intronic
1060941632 9:127546013-127546035 CTGGGTGGTGACGCTGCTGGGGG - Intronic
1061243445 9:129387787-129387809 TTGGATGCTGATAGTGATGGTGG - Intergenic
1061304615 9:129725037-129725059 CCAGATGGGGACAGAGTTGGTGG + Intergenic
1061408959 9:130408002-130408024 CTGGATGGTGCCAGGGTTGGAGG + Intronic
1061845140 9:133383679-133383701 GATGATGGTGACAGTGATGGTGG + Intronic
1062099573 9:134721224-134721246 CTGGATGGGGACAGTTGAGGGGG - Intronic
1062507124 9:136883391-136883413 CTGGATGATGACAGTGTTGAAGG - Intronic
1202788187 9_KI270719v1_random:53372-53394 CTGGTTGGTGACTGTAGTGGGGG - Intergenic
1185854918 X:3524875-3524897 CATGATGGTGACGGTGATGGTGG - Intergenic
1186044895 X:5524976-5524998 CTGAATGGTCACAGAGCTGGAGG - Intergenic
1186569389 X:10698240-10698262 CTGGATGGTTGCAGGGATGGGGG - Intronic
1188743040 X:33809578-33809600 TTGGTTGGTGACGGGGTTGGGGG - Intergenic
1189729289 X:44002010-44002032 CTGGATGTTGATAGTGGGGGAGG + Intergenic
1189929847 X:45997420-45997442 CTGTATCTTGACAGTGGTGGTGG - Intergenic
1190627217 X:52347640-52347662 CTGGATACTGACTGTGATGGTGG - Intergenic
1190700816 X:52988493-52988515 CTGGATACTGACTGTGATGGTGG + Intronic
1193753897 X:85382745-85382767 CTGAATGGGGACAGTCTTGTGGG - Intergenic
1194745410 X:97622611-97622633 ATTGCTGGTGACAGTGATGGGGG + Intergenic
1195564180 X:106323098-106323120 TTGGATGGGCCCAGTGTTGGGGG - Intergenic
1195890589 X:109689241-109689263 CAGGATGGTAACAGTGGAGGTGG - Intronic
1195938213 X:110145172-110145194 CAAGAAGGTGACAGTGTGGGGGG - Intronic
1197231172 X:124005372-124005394 CTTGATGGTGATGGTGATGGTGG - Intronic
1199505283 X:148554454-148554476 CTGGAGGGAGACAGGGCTGGAGG + Intronic
1199874522 X:151920098-151920120 CTGGATGGGGATAGTGGTGTTGG - Intronic