ID: 1001240241

View in Genome Browser
Species Human (GRCh38)
Location 5:170063390-170063412
Sequence GGGTGCACAAACACTTCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001240235_1001240241 9 Left 1001240235 5:170063358-170063380 CCAGATCACAGAACAGAGAGATG 0: 1
1: 0
2: 5
3: 26
4: 243
Right 1001240241 5:170063390-170063412 GGGTGCACAAACACTTCCAGGGG No data
1001240233_1001240241 11 Left 1001240233 5:170063356-170063378 CCCCAGATCACAGAACAGAGAGA 0: 1
1: 0
2: 4
3: 55
4: 424
Right 1001240241 5:170063390-170063412 GGGTGCACAAACACTTCCAGGGG No data
1001240234_1001240241 10 Left 1001240234 5:170063357-170063379 CCCAGATCACAGAACAGAGAGAT 0: 1
1: 2
2: 4
3: 49
4: 413
Right 1001240241 5:170063390-170063412 GGGTGCACAAACACTTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001240241 Original CRISPR GGGTGCACAAACACTTCCAG GGG Intronic
No off target data available for this crispr