ID: 1001243359

View in Genome Browser
Species Human (GRCh38)
Location 5:170086971-170086993
Sequence TGCAACAGAGCCCAGACTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001243359_1001243367 30 Left 1001243359 5:170086971-170086993 CCAGTAGTCTGGGCTCTGTTGCA No data
Right 1001243367 5:170087024-170087046 ACAAGCAACTGGTGGACTCCAGG No data
1001243359_1001243362 -1 Left 1001243359 5:170086971-170086993 CCAGTAGTCTGGGCTCTGTTGCA No data
Right 1001243362 5:170086993-170087015 AGCAAGAAAAGGGAAGAGCAAGG No data
1001243359_1001243366 22 Left 1001243359 5:170086971-170086993 CCAGTAGTCTGGGCTCTGTTGCA No data
Right 1001243366 5:170087016-170087038 CCTTATGGACAAGCAACTGGTGG No data
1001243359_1001243364 19 Left 1001243359 5:170086971-170086993 CCAGTAGTCTGGGCTCTGTTGCA No data
Right 1001243364 5:170087013-170087035 AGGCCTTATGGACAAGCAACTGG No data
1001243359_1001243363 7 Left 1001243359 5:170086971-170086993 CCAGTAGTCTGGGCTCTGTTGCA No data
Right 1001243363 5:170087001-170087023 AAGGGAAGAGCAAGGCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001243359 Original CRISPR TGCAACAGAGCCCAGACTAC TGG (reversed) Intergenic
No off target data available for this crispr