ID: 1001243364

View in Genome Browser
Species Human (GRCh38)
Location 5:170087013-170087035
Sequence AGGCCTTATGGACAAGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001243359_1001243364 19 Left 1001243359 5:170086971-170086993 CCAGTAGTCTGGGCTCTGTTGCA No data
Right 1001243364 5:170087013-170087035 AGGCCTTATGGACAAGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001243364 Original CRISPR AGGCCTTATGGACAAGCAAC TGG Intergenic
No off target data available for this crispr