ID: 1001246464

View in Genome Browser
Species Human (GRCh38)
Location 5:170108664-170108686
Sequence GGTCCTCCATGCCAGCCCCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 8, 3: 25, 4: 274}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001246463_1001246464 -3 Left 1001246463 5:170108644-170108666 CCAGAGAGAAAAGCAGTAGAGGT 0: 1
1: 0
2: 3
3: 28
4: 257
Right 1001246464 5:170108664-170108686 GGTCCTCCATGCCAGCCCCACGG 0: 1
1: 0
2: 8
3: 25
4: 274
1001246461_1001246464 10 Left 1001246461 5:170108631-170108653 CCAGGTGGACATGCCAGAGAGAA 0: 1
1: 0
2: 0
3: 19
4: 146
Right 1001246464 5:170108664-170108686 GGTCCTCCATGCCAGCCCCACGG 0: 1
1: 0
2: 8
3: 25
4: 274
1001246460_1001246464 16 Left 1001246460 5:170108625-170108647 CCTGAGCCAGGTGGACATGCCAG 0: 1
1: 0
2: 2
3: 23
4: 236
Right 1001246464 5:170108664-170108686 GGTCCTCCATGCCAGCCCCACGG 0: 1
1: 0
2: 8
3: 25
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001246464 Original CRISPR GGTCCTCCATGCCAGCCCCA CGG Exonic
900091125 1:921158-921180 TCTGCTCCATGGCAGCCCCAGGG + Intergenic
900163509 1:1235638-1235660 GTGCCTGCATGCCAGCCTCAGGG - Intergenic
900571853 1:3362526-3362548 GGTCCACCAGGCCAGGCTCACGG + Intronic
900573938 1:3373804-3373826 TGCCCTCCCTGCCATCCCCACGG + Intronic
900641865 1:3691432-3691454 GGTGCTTCTTGTCAGCCCCACGG + Intronic
900697867 1:4023346-4023368 GCTCCTCCATGCCAGCCCCTGGG - Intergenic
900830755 1:4963605-4963627 TGTCCTCCTTGTAAGCCCCATGG - Intergenic
901128888 1:6949875-6949897 GGTCCTCACTGCCAGCCTCCGGG + Intronic
901768849 1:11520537-11520559 GGCCCTGCATGCCAGCCCGTGGG - Intronic
902559351 1:17267349-17267371 TGTCCTGAATTCCAGCCCCATGG + Intronic
902721998 1:18309945-18309967 GGGCCTCCATGCACCCCCCAGGG - Intronic
903807786 1:26017723-26017745 CTTCCTCCATCCAAGCCCCAGGG + Intergenic
904487661 1:30838086-30838108 AGTCCTCCATGCCAGGGCCTTGG - Intergenic
905941396 1:41866267-41866289 GGTCCTCCACCCCAGCTTCAGGG + Intronic
907456386 1:54579163-54579185 CGTCCTCAAAGCTAGCCCCAGGG - Intronic
912738208 1:112168843-112168865 GGGCCCTCATGACAGCCCCAAGG - Intergenic
916343978 1:163767316-163767338 GGAGCTCCATTCCAGCCTCAGGG - Intergenic
916487670 1:165273860-165273882 GGTCCTCTATGCCCTCCCAAGGG - Intronic
918067370 1:181110394-181110416 GGTCCTCAATGCCAGACACCTGG + Intergenic
918134352 1:181658493-181658515 GCTACTCCATGCCAGACCCTGGG - Intronic
920493257 1:206435481-206435503 TGTCATCAGTGCCAGCCCCAGGG - Intronic
921070965 1:211657080-211657102 TCTCCCCCATGGCAGCCCCATGG + Intergenic
922012136 1:221599498-221599520 GGTCCTCCTTACTAGCTCCAAGG + Intergenic
922804756 1:228379490-228379512 GGCCCTCCCTGCCAGCTCCCAGG - Intergenic
922934313 1:229411680-229411702 GACCCTCCCTTCCAGCCCCAAGG + Intergenic
923880147 1:238095037-238095059 AGGCCCCCATGCCACCCCCAAGG - Intergenic
923880158 1:238095069-238095091 GGGCCCCCATGCCACCCTCAAGG - Intergenic
1062976280 10:1685831-1685853 GTTCCCCCAGCCCAGCCCCATGG - Intronic
1063145458 10:3291183-3291205 GGTGCTCCATGCCAGGCACCTGG - Intergenic
1063679538 10:8173719-8173741 TGTCTTCCATGCCATCCTCAGGG - Intergenic
1066005366 10:31141748-31141770 GGGCCTCCATGCCAGCCCCTTGG - Intergenic
1067469357 10:46524767-46524789 GGCTTTCCATGCCAGTCCCAGGG - Intergenic
1067697927 10:48548856-48548878 GCTCCTTCATGCCTGCCCCGGGG + Intronic
1067788568 10:49270902-49270924 GGTCTTACATCCCAGCCCCAGGG - Intergenic
1069441630 10:68433988-68434010 GAGCCACCATGCCAGCCCAAGGG - Intronic
1069622983 10:69849289-69849311 GGGCCTCTATGACAGCCCCCAGG - Intronic
1075423838 10:122326693-122326715 GGTCCTACTTGCCAGACCCTGGG - Intronic
1076555862 10:131321052-131321074 GGTGCCCCAGGCCAGCCCCTCGG - Intergenic
1076777779 10:132707620-132707642 GGGCCTCCATGCCATCTCGAGGG + Intronic
1077019256 11:410275-410297 GGGCCACCATGACGGCCCCAGGG + Intronic
1077218653 11:1405576-1405598 GGTCCCCCATCCCAGACCCCTGG - Intronic
1077334321 11:1996743-1996765 TGTCTGCCAAGCCAGCCCCAGGG + Intergenic
1077480719 11:2813214-2813236 GGAGTTCCATCCCAGCCCCAAGG + Intronic
1077516030 11:3002691-3002713 AGCCCTCCATGCCAGGCCCTAGG - Intronic
1078390187 11:10930747-10930769 GGTACCCCATGCCTGGCCCACGG + Intergenic
1078930756 11:15910634-15910656 GGGGCTCCACACCAGCCCCATGG - Intergenic
1081488075 11:43547252-43547274 GGCCCTCCATGTCAGCACCCAGG + Intergenic
1083085029 11:60134118-60134140 GGTACTCTGTGCCAGGCCCAGGG + Intergenic
1083603378 11:63962322-63962344 AGCCCTCCTGGCCAGCCCCAGGG + Intergenic
1083831105 11:65234122-65234144 GGTGCTCCATGCCAGCGCCCTGG + Intergenic
1083909438 11:65697416-65697438 GGTCACCCCAGCCAGCCCCATGG - Intergenic
1086666874 11:89493619-89493641 AGTACTCCAAGCCATCCCCAAGG + Intronic
1089602946 11:119626405-119626427 AGTCCTGCATTCCAGCCCCCTGG - Intronic
1089770687 11:120800307-120800329 GGTCCTCCCTGGCAGGCCCCTGG - Intronic
1090241749 11:125188284-125188306 AGTCCTCCAACCCACCCCCAGGG - Intronic
1091100592 11:132869162-132869184 GATTCTTCATGCTAGCCCCATGG - Intronic
1202817304 11_KI270721v1_random:51925-51947 TGTCTGCCAAGCCAGCCCCAGGG + Intergenic
1091446989 12:549561-549583 GGCCCCCTCTGCCAGCCCCACGG - Intronic
1092009603 12:5098434-5098456 AGTCCTCCATGAGAGCCCCAGGG + Intergenic
1094348690 12:29499145-29499167 GAACCACCATGCCAGCTCCAGGG + Intergenic
1095504697 12:42882652-42882674 GTTTCTCCAAGCCAGCCCAAAGG + Intergenic
1095943252 12:47739781-47739803 GGCGCTCCATGCCAGGCCCTTGG + Intronic
1096468520 12:51862210-51862232 GGTCATCCTTGCCAGGGCCAGGG - Intergenic
1096649054 12:53053045-53053067 GCTCCCCCAAGCCAGCTCCAGGG - Intronic
1097767517 12:63542888-63542910 TGGACTCCATTCCAGCCCCAAGG + Intergenic
1097783883 12:63737936-63737958 TGGACTCCATTCCAGCCCCAAGG + Intergenic
1099270078 12:80497521-80497543 GGTCCCCAATCCCAGCGCCACGG - Intronic
1101449999 12:104767383-104767405 CCTCCTCCATCTCAGCCCCAGGG + Intergenic
1102534446 12:113570115-113570137 GGGGCTTCATGCCAGGCCCAAGG + Intergenic
1102780679 12:115562053-115562075 GGTCATCCCTGCCGGGCCCAGGG + Intergenic
1104857862 12:131910273-131910295 TTTCCTCGATGCCAGCCCCTCGG + Exonic
1104937683 12:132375240-132375262 TGTCCCCCAGGCCATCCCCATGG - Intergenic
1104983180 12:132582950-132582972 GGTCCGCCCTGCCGCCCCCAGGG + Exonic
1105440991 13:20415312-20415334 GGGCCTCCAGGGCAGCCCCAGGG + Intronic
1106551090 13:30771751-30771773 GGTCCTCAATGTCAGCACTATGG + Intergenic
1107691101 13:42954163-42954185 GGTACTCCCTGTCAGACCCATGG + Intronic
1109130208 13:58575058-58575080 GGTTTTGCATGCCAGTCCCAGGG - Intergenic
1112093462 13:96107497-96107519 GGTCCACAGTGCTAGCCCCAGGG + Intronic
1113902251 13:113803820-113803842 GGGGCTCCCTCCCAGCCCCAGGG + Intronic
1117057659 14:51929501-51929523 GCTCCTCCAAGCAAGGCCCAAGG + Intronic
1118760522 14:68878161-68878183 AGTCCTTCCTGCCAGCCTCAGGG + Intronic
1119485275 14:74982664-74982686 GGTCCTCAGGGCCAGGCCCATGG + Intergenic
1119616686 14:76103374-76103396 AGTCCTTCATCCCAGCCCCAGGG - Intergenic
1120049375 14:79847492-79847514 TGTCCCCCATGCCAACCCCTGGG + Intronic
1121127742 14:91418409-91418431 TGCCCTCCAGCCCAGCCCCAGGG - Intergenic
1121495501 14:94389167-94389189 GGCCCCCCATGCCAGCCTGACGG - Intronic
1121584625 14:95054774-95054796 GCTCCTCTGTGCCAGGCCCAGGG + Intergenic
1121970901 14:98354931-98354953 AGGCCTCCATGTCTGCCCCAGGG + Intergenic
1122195109 14:100078940-100078962 GGACCACCATGCCAGTCCCAGGG + Intronic
1122633451 14:103118726-103118748 GGTGCCCCACCCCAGCCCCACGG - Intergenic
1122938004 14:104968682-104968704 TCTCCTCCCTGCCAGCCCCCAGG - Intronic
1123627841 15:22239683-22239705 GGCCCTCCTTGTCAGCACCAGGG - Intergenic
1124899307 15:33807687-33807709 GGTCCCCCAGGCCTGCTCCAGGG + Intronic
1125672610 15:41484947-41484969 GGTTCCACAGGCCAGCCCCAGGG + Intergenic
1127972621 15:63973369-63973391 AGACCTCCATTCCACCCCCATGG + Intronic
1128604755 15:69028304-69028326 GCTCATCCATGGCAGCCCCATGG + Exonic
1130906465 15:88244061-88244083 TGTTCTCCATGCCAGCCACTGGG + Intronic
1132514038 16:358037-358059 GAACCTCCATGCCAGGCCCCAGG - Intergenic
1132572044 16:648424-648446 GCTCCTCCCTGCCAGCCCCAGGG - Exonic
1133763475 16:8818835-8818857 GGTACTCCATGCCAGGCCCAGGG - Intronic
1134043686 16:11086241-11086263 GCTCCTCCCCACCAGCCCCATGG - Intronic
1134236270 16:12468673-12468695 TGTTCTCCATGATAGCCCCAGGG + Intronic
1136361853 16:29785690-29785712 GGTCCTGCTTCCCAGCCCCCAGG - Intergenic
1137564444 16:49524553-49524575 CCTTCTCCATGCCAGGCCCAGGG - Intronic
1137634975 16:49978245-49978267 TGGACTCCATGCCAGACCCACGG + Intergenic
1137897372 16:52228685-52228707 GGTCCTGAATGCCAGCCATAGGG + Intergenic
1141515019 16:84538105-84538127 GCTCCTTCACGCCAGCCCCAGGG + Intronic
1141579325 16:84986490-84986512 TGTCTTCAATGCCAGCCCCGTGG - Intronic
1141594575 16:85089473-85089495 GGTACTCCAGGCCAGCCCATGGG + Exonic
1141775265 16:86118724-86118746 GTACCTACCTGCCAGCCCCAGGG + Intergenic
1141976117 16:87517669-87517691 GGCCCTCCTTGTCAGCGCCAGGG + Intergenic
1142024127 16:87803404-87803426 GGAGCTCCAGGCAAGCCCCATGG + Intergenic
1142211297 16:88809890-88809912 GGTGCTCCAGGCCAGCCCCTGGG + Intronic
1203141652 16_KI270728v1_random:1771267-1771289 ATTCCTCCTTCCCAGCCCCAAGG + Intergenic
1203141715 16_KI270728v1_random:1771459-1771481 CCTCCTCCATCCCAGCCCCAGGG + Intergenic
1203141851 16_KI270728v1_random:1771955-1771977 CTTCCTCCATCCCAGCCCCGCGG + Intergenic
1144472273 17:15555575-15555597 GCTCCTCCATCCCTGCCCCTAGG + Intronic
1144889744 17:18487783-18487805 GGCCCTGCATCCCAGCCCCTGGG - Intronic
1144924201 17:18789119-18789141 GCTCCTCCATCCCTGCCCCTAGG - Intronic
1145106432 17:20121737-20121759 GGTCCTCCCTGCCTGCCCCAGGG + Intronic
1145142467 17:20456513-20456535 GGCCCTGCATCCCAGCCCCTGGG + Intronic
1145793438 17:27642374-27642396 GGCCCTGCATCCCAGCCCCTGGG - Intronic
1145808242 17:27749920-27749942 GGCCCTGCATCCCAGCCCCTGGG - Intergenic
1146883857 17:36457991-36458013 CATCCCCCATGACAGCCCCAAGG + Intergenic
1147383974 17:40071152-40071174 AGCCCTCCTTGCCAGCCACAGGG - Intronic
1147450862 17:40502938-40502960 GGCTATCCATACCAGCCCCAGGG - Intergenic
1147645212 17:42029139-42029161 GGCCCTCCAGGCCACCTCCATGG - Intronic
1147840608 17:43368983-43369005 GGTCCTCCGGGCCCACCCCAGGG - Intergenic
1148206559 17:45783744-45783766 GCTCCTCCTAGCCAGCCGCAGGG + Intergenic
1148953704 17:51336179-51336201 GGTTCTCCATGCAAGGCCAAGGG - Intergenic
1149651720 17:58280079-58280101 GGTCCTGCATGTCTGCCCCTGGG - Intronic
1150249360 17:63697738-63697760 GTCCCCCCATGCCCGCCCCATGG + Exonic
1151601546 17:75109328-75109350 CGCCCTCCATCCCAGCCCCGAGG - Intergenic
1151654719 17:75490507-75490529 GGGCCTCCAGGCCAGGCCCTGGG + Intronic
1151704165 17:75758000-75758022 GGGCCTGCAGGCCAGTCCCACGG - Exonic
1152727194 17:81953182-81953204 GAGCCTCCATGACAGCCACAAGG - Exonic
1153499121 18:5730369-5730391 GGTACCCCATGGCAGGCCCAAGG - Intergenic
1155038601 18:22045873-22045895 AGTCCTCCCTGCAAGCCCCCAGG - Intergenic
1157123791 18:44936370-44936392 GCCCCTCCAAGCCTGCCCCATGG + Intronic
1157581257 18:48775543-48775565 GGGCCTCCAGGCCAGTCCCAGGG - Intronic
1160010934 18:75106802-75106824 TGCCCTCCACGCAAGCCCCAAGG + Intergenic
1161018064 19:1993208-1993230 GGACCGCCATGCCCGCCCCCAGG + Intronic
1161338602 19:3728420-3728442 GCTCCTCCATGTCAGCCACCTGG - Exonic
1162056221 19:8065738-8065760 GGGCCTCTGTGCCAGCCCCGGGG - Exonic
1163483539 19:17572968-17572990 GGCCCTGGATACCAGCCCCAGGG - Intronic
1163672695 19:18637787-18637809 GCTCCTCCCTTCCATCCCCATGG + Intronic
1163754350 19:19097605-19097627 GGTCCGCCTGGCCAGCCCCAAGG + Intronic
1163795179 19:19333910-19333932 GCTCCCCCTTGCCAGCCCCATGG + Intronic
1165308062 19:35014137-35014159 CCACCTCCATCCCAGCCCCAGGG - Intronic
1166128239 19:40729431-40729453 TGCCCTCCATCCCTGCCCCAGGG - Intronic
1167464953 19:49645794-49645816 CCTCCTGCATGCCAGCCCCAAGG - Intronic
1168589186 19:57618558-57618580 GGTCCTACATACCAGGCCCATGG + Intronic
1168724221 19:58571960-58571982 GTTCCACCATGCCAGCCCACAGG + Intronic
925082311 2:1080056-1080078 GGTCCTCCATGAGAGCCCCACGG + Intronic
926172356 2:10560410-10560432 TTTACTCCCTGCCAGCCCCAGGG + Intergenic
927199656 2:20570534-20570556 GAGCCTCCATTGCAGCCCCAAGG + Intronic
927518830 2:23687353-23687375 TGTCCACCACTCCAGCCCCAGGG + Intronic
927838901 2:26424467-26424489 GGCCCTCCAGCCCAGCCACAGGG + Intronic
928451882 2:31385088-31385110 GGTCCCCCACCCCAGCCTCAAGG - Intronic
929993772 2:46812158-46812180 GGACCCCCAAGCCAGCCCAAAGG - Intergenic
931307510 2:61044927-61044949 GGACCTCCATGCAAGCACAAAGG + Intronic
933235839 2:79863705-79863727 AGTGCCCTATGCCAGCCCCAGGG - Intronic
936522080 2:113217788-113217810 CGTCAGCCAGGCCAGCCCCAGGG - Exonic
939175126 2:138739539-138739561 GGTCCTGCATACCTGCCACATGG + Intronic
939740039 2:145894705-145894727 GGTAGTCCATGACTGCCCCAAGG + Intergenic
940289774 2:152067240-152067262 GCTTCTGCATGTCAGCCCCAAGG + Intronic
947572172 2:231244794-231244816 GCTCCTCCATGCCGCCCTCATGG - Intronic
947910267 2:233796063-233796085 GGTGCTCCCTGCCTGCCCCGAGG + Intronic
947934870 2:233995952-233995974 GGGCCACCATGCTAGTCCCAAGG + Intronic
948324332 2:237100685-237100707 GGTCCCCGATCCCCGCCCCAAGG - Intergenic
948591374 2:239052986-239053008 GGTGCTCCAAGAGAGCCCCACGG + Exonic
948619723 2:239226844-239226866 GGTCCCACCTGCCAGCCACAGGG + Intronic
948641221 2:239377140-239377162 GCTCCTCTATGGCAGCCCAAAGG + Intronic
1168763711 20:367587-367609 TGCCCTCCATGCCCACCCCAGGG + Intronic
1170517860 20:17150159-17150181 TGTGCTCCAGGACAGCCCCATGG - Intergenic
1170956444 20:20984333-20984355 AGTCCTCCATTCTTGCCCCAAGG - Intergenic
1171063406 20:21988338-21988360 GGGAATCCAGGCCAGCCCCAAGG + Intergenic
1171400145 20:24867937-24867959 GATCCACCATGGAAGCCCCAGGG + Intergenic
1172133694 20:32673263-32673285 TGTCCCCCATGGCAGCCACAGGG - Intergenic
1173333257 20:42093108-42093130 GATCCTGCATGCCAGCCAAAGGG - Intronic
1175493965 20:59400094-59400116 TGTCCCCCTTGCCGGCCCCAGGG + Intergenic
1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG + Intronic
1175963240 20:62647573-62647595 GGTCAGCCAGGCCAGGCCCAGGG + Intronic
1175986695 20:62767755-62767777 GGCCCTCCCTCCCATCCCCACGG + Intergenic
1176052915 20:63130061-63130083 GCTCCTGCACTCCAGCCCCAAGG - Intergenic
1176217844 20:63956601-63956623 GGTCCCCCATGCCCGCCGCGCGG - Intergenic
1177608263 21:23410080-23410102 GGTCCCCCATTGTAGCCCCAAGG - Intergenic
1180699889 22:17775530-17775552 GTTCCTCCTCGGCAGCCCCATGG + Intergenic
1180832268 22:18912296-18912318 GGGCCCCCATCCAAGCCCCAGGG + Intronic
1181067574 22:20314046-20314068 GGGCCCCCATCCAAGCCCCAGGG - Intergenic
1182684061 22:32107167-32107189 GTTCCTGCCTGCCTGCCCCAGGG - Intronic
1183295369 22:37026131-37026153 GGTTCTCCATCTCAGCCCCAGGG + Intronic
1183544596 22:38448836-38448858 TCTCCTCCATCCCAGTCCCAGGG + Intronic
1184045183 22:41968894-41968916 GGGCTCCCATCCCAGCCCCAGGG + Intergenic
1184697490 22:46148144-46148166 GGTCCCCCAGGCCAGCGGCAGGG - Intergenic
1185124924 22:49004630-49004652 GCTCCCCCAGGCGAGCCCCACGG - Intergenic
1185347639 22:50317412-50317434 GGACCACCTGGCCAGCCCCAGGG + Intronic
1203282353 22_KI270734v1_random:137601-137623 GGGCCCCCATCCAAGCCCCAGGG + Intergenic
950018438 3:9769846-9769868 GGGCCTCCCAGCCAGCCCCGCGG - Exonic
953455085 3:43034608-43034630 GGTCCTCAATGTCAGCCCTTAGG + Intronic
954463370 3:50640365-50640387 GCTCCTGTATGACAGCCCCAAGG + Exonic
954537429 3:51371721-51371743 GGTCTTCCTTGCCATACCCATGG + Intronic
954714761 3:52521514-52521536 GGCCATCCCTGCCTGCCCCACGG + Intronic
955403243 3:58608691-58608713 TGTCCCCCATGCCACCTCCAAGG - Intronic
961104257 3:124227852-124227874 GGTCCTACAGCCCAGCCCGATGG - Intronic
961931049 3:130533005-130533027 GAGCCTACATGCCAGCTCCAAGG + Intergenic
966752735 3:183338160-183338182 GAGCCACCATGCCAGCCCCAGGG - Intronic
968311581 3:197687971-197687993 GATGCTCCATCTCAGCCCCAGGG + Intronic
968928927 4:3565821-3565843 GGTCCACTCTGCCAGCCACAAGG - Intergenic
968952899 4:3703730-3703752 GGGCCGACATGCCAGCCCCACGG + Intergenic
969313896 4:6370169-6370191 GGGCCTCCATGCCTGGTCCAGGG - Intronic
970472208 4:16390045-16390067 ATTCCTCCATCCCAACCCCAGGG + Intergenic
970620298 4:17810969-17810991 AGTCTTCTATGACAGCCCCAGGG - Exonic
977554040 4:98470835-98470857 GGTTTTCCATTTCAGCCCCATGG - Exonic
985711558 5:1432395-1432417 GGTCCCCCATGGTAGCCCCTTGG - Intronic
986270584 5:6227394-6227416 GCTTTTCCATGCCAGCCTCAAGG + Intergenic
989646888 5:43643956-43643978 GGGCCTGCTTGCCAGCCACATGG + Intronic
994157835 5:96523285-96523307 GGTCCTGCATGGCATCCCTATGG - Intergenic
996425978 5:123313674-123313696 GGACCTCCATACACGCCCCAAGG - Intergenic
1001246464 5:170108664-170108686 GGTCCTCCATGCCAGCCCCACGG + Exonic
1001415957 5:171545030-171545052 AGTGTTCCATGCCAGGCCCACGG + Intergenic
1001549033 5:172588634-172588656 GGTCCTCCATGCCAGGCAAGGGG + Intergenic
1003043719 6:2713705-2713727 GGTCCTCAATGACCTCCCCAGGG - Intronic
1006267253 6:32935744-32935766 GGTCCTTTATCCCAGCTCCAAGG + Intronic
1006595847 6:35192171-35192193 GGTCCTCCAAGTCACCCACATGG + Intergenic
1006806161 6:36791036-36791058 GGTCATCCCTCCCAGCTCCATGG + Intronic
1007599751 6:43074630-43074652 GGGCCTCAGTGCCAGCACCATGG + Exonic
1008584573 6:52937084-52937106 GGACCTCCATGGCAGCAGCAGGG + Intergenic
1012439031 6:99245142-99245164 GGACCTCCAAGGCAGCTCCAGGG + Intergenic
1015106199 6:129539600-129539622 GGTGCTCTATCCCAGCCCCAGGG + Intergenic
1015761272 6:136663997-136664019 GGTCCTCAATCCCAGGGCCATGG + Intronic
1015874432 6:137808804-137808826 GTTCCCCCACGACAGCCCCACGG + Intergenic
1016850430 6:148613498-148613520 TGTCTTCCATGCCAGGCCGAGGG - Intergenic
1017290808 6:152733730-152733752 AGTCCTTCTTGCCAGCTCCAAGG - Intergenic
1018746348 6:166765052-166765074 TCTCCTCCCTGCCAGCTCCAGGG + Intronic
1019184211 6:170211678-170211700 GGTCCTGCATGCCAGGCTGAGGG + Intergenic
1019281147 7:200900-200922 CCTCCTTGATGCCAGCCCCAGGG + Intronic
1020377207 7:7501722-7501744 GAGCCACCATGACAGCCCCATGG + Intronic
1022141842 7:27499618-27499640 AGTCTTCCATTCCAGACCCACGG - Intergenic
1022277662 7:28871752-28871774 AGTCCTCAAAGCCAGCCCAATGG + Intergenic
1022323834 7:29311736-29311758 ATTCCTACATGCCAGCCCCTGGG - Intronic
1023675090 7:42620706-42620728 TGTCCTCCATGCCAGGGTCATGG + Intergenic
1026673319 7:72408146-72408168 GAGCCTCCATGCCAGGCCTACGG - Intronic
1028984499 7:96998976-96998998 CTTCCTTCATCCCAGCCCCATGG + Intergenic
1029283778 7:99452738-99452760 CGCCCTCCATGCCAGCCCCAGGG - Intronic
1029735570 7:102464149-102464171 GTCCTTCCATGCCAGCCCAAAGG + Intronic
1030005407 7:105113130-105113152 GGTCCTCATCTCCAGCCCCAAGG + Exonic
1030267057 7:107631611-107631633 GGTCCTCTGTACCAGCCCCTAGG + Intergenic
1032076588 7:128838909-128838931 AGTCCTCCATCCCACCCCCAAGG + Intronic
1032855745 7:135832347-135832369 CATCCTCCATGCAAGCCCCGTGG - Intergenic
1033235844 7:139637214-139637236 CTTCCTCCATGGCAGCCACAGGG + Intronic
1034456914 7:151175602-151175624 GGGGCTCCCTGCCTGCCCCACGG - Intergenic
1035236464 7:157500719-157500741 TGTTCTCCCCGCCAGCCCCAGGG + Intergenic
1035700655 8:1637184-1637206 GGGCCTCCTTGCCAGCCCTCTGG - Intronic
1036562839 8:9912118-9912140 GCAGCTCCATGCCAGCCACAGGG + Intergenic
1040617190 8:49048399-49048421 GGGCCCCCAAACCAGCCCCATGG - Intergenic
1041016085 8:53594462-53594484 GGCCCTCCATGCCAACCCCAGGG - Intergenic
1041107145 8:54454577-54454599 ATTCCTCCAGGTCAGCCCCACGG + Intergenic
1041513279 8:58674126-58674148 TGACCTCCCTCCCAGCCCCACGG + Intergenic
1043201737 8:77378435-77378457 GCTCCTCCAGGCAAGGCCCAAGG - Intergenic
1045392963 8:101733460-101733482 GGTCCTCCAAAACAGCCCTATGG - Intronic
1046004687 8:108464576-108464598 GGTCCTCCGTACCAACCCCTGGG - Intronic
1048256690 8:132910235-132910257 GGCCCTGAAAGCCAGCCCCAGGG - Intronic
1049031841 8:140043879-140043901 GGCCCTCCCAGCCTGCCCCATGG + Intronic
1049479815 8:142816579-142816601 GGCCCCACCTGCCAGCCCCATGG + Intergenic
1049678450 8:143904082-143904104 GCCCTTCCATGCCAGGCCCAGGG + Intergenic
1050537729 9:6645236-6645258 GGTCCTTACCGCCAGCCCCAAGG + Exonic
1053803636 9:41779405-41779427 GGTCCACTCTGCCAGCCACAAGG - Intergenic
1054141632 9:61535718-61535740 GGTCCACTCTGCCAGCCACAAGG + Intergenic
1054191936 9:61990797-61990819 GGTCCACTCTGCCAGCCACAAGG - Intergenic
1054461332 9:65466441-65466463 GGTCCACTCTGCCAGCCACAAGG + Intergenic
1054646444 9:67596993-67597015 GGTCCACTCTGCCAGCCACAAGG + Intergenic
1055377586 9:75666572-75666594 GGTGCTCCAAGCTGGCCCCACGG + Intergenic
1057019075 9:91681683-91681705 GGGCCTCTGTGCCAGCCCCCGGG - Intronic
1057024667 9:91725803-91725825 GGGCCTCCGTGCAAGCCCCGGGG + Intronic
1057303826 9:93901359-93901381 TGTCCTCCACTCCAGGCCCAGGG + Intergenic
1060829161 9:126702956-126702978 GGTCCTCCAGGTCAGGCCCAGGG + Intergenic
1061414470 9:130438852-130438874 TGTCCTCCAGGCCAGACCCTAGG - Intergenic
1061907709 9:133707405-133707427 GGTCCACCAAGCCAGGCCAAAGG + Intronic
1062122009 9:134838899-134838921 GTCCCTGCATGCCACCCCCATGG - Intronic
1203761112 EBV:13300-13322 GGTCCACCAGGCCAGCCGGAGGG + Intergenic
1203762041 EBV:16372-16394 GGTCCACCAGGCCAGCCGGAGGG + Intergenic
1203762970 EBV:19444-19466 GGTCCACCAGGCCAGCCGGAGGG + Intergenic
1203763899 EBV:22516-22538 GGTCCACCAGGCCAGCCGGAGGG + Intergenic
1203764828 EBV:25588-25610 GGTCCACCAGGCCAGCCGGAGGG + Intergenic
1203765757 EBV:28660-28682 GGTCCACCAGGCCAGCCGGAGGG + Intergenic
1203766686 EBV:31732-31754 GGTCCACCAGGCCAGCCGGAGGG + Intergenic
1203767615 EBV:34804-34826 GGTCCACCAGGCCAGCCGGAGGG + Intergenic
1185550588 X:980523-980545 CTTCCTCCATCCCAGCCCCAGGG - Intergenic
1185550694 X:980889-980911 CCTCCTCCATCCCAGCCCCAGGG - Intergenic
1185550711 X:980940-980962 CCTCCTCCATCCCAGCCCCAGGG - Intergenic
1185550757 X:981087-981109 CCTCCTCCATCCTAGCCCCAGGG - Intergenic
1185550822 X:981294-981316 CCTCCTCCATCCTAGCCCCAGGG - Intergenic
1185550870 X:981447-981469 CCTCCTCCATCCCAGCCCCAGGG - Intergenic
1186087266 X:6003879-6003901 TGAACTCCATACCAGCCCCACGG - Intronic
1186207514 X:7215956-7215978 GGTCCTGCTTGGCACCCCCAGGG + Intergenic
1188137094 X:26504340-26504362 GGTCCTCCATGCCCCCCCTGGGG + Intergenic
1192240114 X:69321900-69321922 GGTCCTCCCTTCCTGGCCCAGGG - Intergenic
1195678808 X:107528143-107528165 GGCTATGCATGCCAGCCCCATGG - Intronic
1195740923 X:108063745-108063767 GGTCCTCTCTGCCTGCCCCCAGG - Intronic
1196458114 X:115903957-115903979 GGTCCTCTTTGACAGCCCTAGGG + Intergenic
1197777737 X:130130360-130130382 GGTCTTCCTTGCCAGCTCCTGGG + Intronic
1198810835 X:140534684-140534706 AGTTCTACATGCCAGACCCAGGG + Intergenic
1199383293 X:147194697-147194719 GGTACTCAATGCCAGCCCATTGG + Intergenic
1200207184 X:154325145-154325167 TGTCCTTCAGGGCAGCCCCAAGG + Intronic
1201904694 Y:19076917-19076939 GGCCCTCCAGGCCTGACCCAAGG + Intergenic
1202376832 Y:24246008-24246030 TGCCCTCCATGCCTTCCCCAGGG + Intergenic
1202493948 Y:25424113-25424135 TGCCCTCCATGCCTTCCCCAGGG - Intergenic