ID: 1001246473

View in Genome Browser
Species Human (GRCh38)
Location 5:170108691-170108713
Sequence TCTGGGCAGTTCCGCAGTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001246473_1001246484 30 Left 1001246473 5:170108691-170108713 CCATGACTGCGGAACTGCCCAGA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1001246484 5:170108744-170108766 TCTTTCTAGAACACTGGTTAAGG 0: 1
1: 0
2: 0
3: 13
4: 166
1001246473_1001246477 -2 Left 1001246473 5:170108691-170108713 CCATGACTGCGGAACTGCCCAGA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1001246477 5:170108712-170108734 GACATAAGCAGGAGCCTCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 82
1001246473_1001246481 24 Left 1001246473 5:170108691-170108713 CCATGACTGCGGAACTGCCCAGA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1001246481 5:170108738-170108760 CCACCCTCTTTCTAGAACACTGG 0: 1
1: 0
2: 0
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001246473 Original CRISPR TCTGGGCAGTTCCGCAGTCA TGG (reversed) Exonic
900971971 1:5996780-5996802 TCTCGGCTGCTCGGCAGTCAGGG - Intronic
900997240 1:6129235-6129257 TGTGGGAGGCTCCGCAGTCAGGG - Intronic
901127836 1:6941724-6941746 TCTGGGCAGTCCTGCAGTGCAGG + Intronic
904266878 1:29323371-29323393 TCTGGCCAGTACTGCAGGCAGGG - Exonic
904626961 1:31811817-31811839 GATGGGCTGTGCCGCAGTCAAGG + Intronic
906744993 1:48215333-48215355 TCAGGGCTGTTCCTCACTCAGGG + Intergenic
907381296 1:54092694-54092716 TGTGGGAAGTTCCGCACTTAAGG + Intronic
911739559 1:101372177-101372199 TCTGGGTAGTTACCCAGTGATGG + Intergenic
915319323 1:155047641-155047663 ACAGGGCAGTTCTGCAGTGAGGG + Intronic
916645973 1:166785354-166785376 TCTGTGCAGTGGCACAGTCATGG + Intergenic
916646362 1:166789684-166789706 TCTGTGCAGTGGCACAGTCATGG + Intergenic
921041673 1:211438680-211438702 TCTGGACAGTTCCGTTGTCGTGG + Intergenic
921131247 1:212221832-212221854 TCTGTGCAGCTGTGCAGTCAAGG - Intergenic
921206896 1:212857337-212857359 TCTGGACAATTCCGCAGACTTGG - Intergenic
924451475 1:244182622-244182644 TCTGGGCAGTTCAGGACTTAAGG + Intergenic
1069905770 10:71731191-71731213 TCTGGCCTGTACCCCAGTCAGGG + Intronic
1072511447 10:96130124-96130146 TCTGGGCAGTCCCGCTGACGGGG - Intronic
1075871275 10:125774020-125774042 CCTGGGCAGCTCCGCCGTCGGGG + Exonic
1076011026 10:126988541-126988563 TCTGAGCAATTCTGTAGTCAGGG + Intronic
1080505040 11:32904145-32904167 TCTAGGCCTTTCTGCAGTCAAGG + Intronic
1087027824 11:93668501-93668523 TATGGGTAGTTTCCCAGTCAGGG - Intronic
1092784559 12:12015584-12015606 TCTGGGCAGTTACGCAGCCAGGG - Intergenic
1093740872 12:22686289-22686311 TCTGTGTAGTTGAGCAGTCATGG + Exonic
1094477520 12:30852780-30852802 TATGAGCAGTTCAGCAGTGAGGG + Intergenic
1095904216 12:47360927-47360949 TACGGGCACTTCCTCAGTCAAGG + Intergenic
1097901228 12:64875531-64875553 TCTGGGCAGTGCCGCTGGCAGGG - Exonic
1101200606 12:102431862-102431884 TCTGTGCACTTCCGCAGTTTAGG + Intronic
1104846704 12:131850654-131850676 TGTGGGCAGCTCTGCAGGCATGG - Intronic
1107975923 13:45688469-45688491 TCTGGGAAGCTCAGCAGCCATGG - Intergenic
1112154942 13:96807156-96807178 TCTGGGCATTTGCACAGGCATGG - Intronic
1112188445 13:97150844-97150866 CCTGGGCAGCCCCACAGTCAAGG - Intergenic
1113545288 13:111144191-111144213 TCTGGCCAGTTCCATACTCATGG + Intronic
1118108826 14:62693364-62693386 TCTGGACAGTTCAACAGTGAAGG - Intergenic
1122513001 14:102285137-102285159 TCTGGTCAGTTCCACACCCAAGG - Intronic
1122696217 14:103553921-103553943 TCTGGGCAGTTCCCTGGGCAAGG + Intergenic
1124059774 15:26279423-26279445 TCTGGGTAGATACCCAGTCATGG + Intergenic
1128879511 15:71230439-71230461 TCAGGGCAGTGCAGCCGTCACGG + Intronic
1129870251 15:78935504-78935526 TCTCAGCAGTTCCTCAGTCCAGG - Intronic
1132677826 16:1127888-1127910 TCCGGGCAGTTCTGCAGTTAGGG + Intergenic
1133110141 16:3543138-3543160 TCTGGGCAGATCCAAAGTCCTGG - Intronic
1133617838 16:7495319-7495341 TTTGGGTATTTCCCCAGTCATGG + Intronic
1135386099 16:22041726-22041748 GCTGGGCAGTTGCTCAGTCATGG + Intronic
1136158762 16:28403816-28403838 TCTCGGCGTTTCCGCTGTCAGGG - Exonic
1136204326 16:28711467-28711489 TCTCGGCGTTTCCGCTGTCAGGG + Exonic
1138206618 16:55130314-55130336 TCTGGTGTGTTCTGCAGTCAGGG - Intergenic
1141000090 16:80299746-80299768 TGTTGGCAGTTCAGCAGTCAGGG + Intergenic
1144042752 17:11427532-11427554 TCTGGCCAGTTCAGCACTGAGGG - Intronic
1145797812 17:27666134-27666156 TCCTGGCAGTTCCGGAGTCCTGG + Intergenic
1146669070 17:34724379-34724401 TCTGGGGAGCTCCCCAGCCAAGG - Intergenic
1147050186 17:37788566-37788588 TCTGGGTAGATACCCAGTCATGG + Intergenic
1151396617 17:73827122-73827144 TCTGGACAGGTCTGGAGTCAGGG - Intergenic
1151766848 17:76137309-76137331 TCTGGACAGTGCCCAAGTCAGGG - Exonic
1151858712 17:76742252-76742274 TCTGGGCACTTCTGCAGTCTAGG + Exonic
1153510472 18:5846573-5846595 GCTGGCCAGTTCAGCTGTCAAGG - Intergenic
1153753582 18:8258390-8258412 TCAGGGCAGAGCTGCAGTCATGG - Intronic
1155524884 18:26705898-26705920 TCTGAGCAGTTCAGCAGGCATGG - Intergenic
1156894877 18:42234668-42234690 TCTGGGCAGATACCCAGTGATGG - Intergenic
1161020760 19:2010360-2010382 TCTGGGCTGTTCCCCGGTCCTGG - Intronic
1164196309 19:22965917-22965939 TCGGGGCAGATCCCCAGTAATGG + Intergenic
1164642496 19:29836643-29836665 TCTGGGCAGCCCTGCAGGCAGGG + Intergenic
925298068 2:2791408-2791430 TCTGGGAGGTTCCGCAGCCAGGG - Intergenic
926151540 2:10428325-10428347 TCTGGGCAGTACAGCTGACATGG + Intergenic
926408951 2:12581931-12581953 TGTGGGCAGTTCATCATTCAGGG - Intergenic
934943292 2:98518264-98518286 TCTGGGCATCTCTGCAGACACGG - Intronic
944412064 2:199455994-199456016 TCGGGGCTGTCCCGCAGACACGG + Exonic
946275759 2:218630456-218630478 TGTGGGCAGTGTCGCAGGCATGG + Intronic
946747818 2:222862619-222862641 TCTGGGCAGTTCCTCACACTTGG + Intronic
947565471 2:231190478-231190500 CCAGGGCAGCTCCACAGTCAGGG + Intergenic
948701804 2:239765286-239765308 TCTGGGCAGTCCTCCCGTCATGG - Intronic
948950426 2:241247448-241247470 TCTGGGCAATTCTGCACTCACGG + Intronic
1172396945 20:34614244-34614266 GATGTGCAGTGCCGCAGTCACGG - Intronic
1172648084 20:36483945-36483967 CCAGGCCAGTTCCCCAGTCAGGG - Intronic
1173643644 20:44620257-44620279 TCTGGGCAGTTGCCCTGTCCTGG - Intronic
1173659670 20:44724666-44724688 TCTGGGCAGCTCTGCAGAGAAGG + Intronic
1177000737 21:15609145-15609167 TCTGGGGAATTCAGCATTCAAGG + Intergenic
1178704111 21:34858709-34858731 GCTGGGCAGTTCCACAGACCTGG + Intronic
1181601519 22:23954998-23955020 TCAGGGCTCTTCCGCAGTCCAGG - Intergenic
1182519286 22:30876321-30876343 TCTGGACAGTTCTCCAGTCATGG + Intronic
1184249560 22:43252454-43252476 GCTGGCCAGTGCTGCAGTCAAGG + Intronic
1184609758 22:45595174-45595196 TGTGGGCAGGTCCGCTGACAGGG + Intronic
949452030 3:4196561-4196583 TCTGGGAAGTGCCTCAGCCAAGG - Intronic
951353538 3:21636060-21636082 TCTGGGTAGATACCCAGTCATGG + Intronic
953377954 3:42444701-42444723 ACTGGGCAGTGCCCCAGTGAGGG - Intergenic
954533231 3:51338690-51338712 TCAGGGCAGATCAGGAGTCAGGG - Intronic
956939026 3:74135941-74135963 TCTGGGGAGTGCGGCAGCCATGG + Intergenic
963748949 3:149154783-149154805 TATAGGGACTTCCGCAGTCAAGG + Intronic
967713359 3:192735209-192735231 TCTGGGCAGAACAGCAGTCTTGG - Intronic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
979712207 4:123792832-123792854 TCTGGGCAGATACCCAGTAATGG + Intergenic
987991389 5:25217109-25217131 TCTGGGTATTTACCCAGTCATGG - Intergenic
1000124620 5:158231810-158231832 TCTGAGAAGTTCTGCAGTAAAGG - Intergenic
1000660458 5:163932729-163932751 TCTGGGAAGTACCCCAGCCAGGG + Intergenic
1001246473 5:170108691-170108713 TCTGGGCAGTTCCGCAGTCATGG - Exonic
1003213259 6:4087019-4087041 TCTGGGCATTTCCTCAGTTTTGG + Intronic
1011192164 6:84740544-84740566 TCTGGGCAGTTTGGCAGACCTGG + Intronic
1016805240 6:148205774-148205796 TCAGGGCAGGTCAGCAGACAGGG - Intergenic
1020596328 7:10212286-10212308 TCTGGGCATTTCAGCAGCCTTGG - Intergenic
1021946788 7:25735583-25735605 TCTGGGCTGTTCAGCAGTGAAGG - Intergenic
1025069204 7:55884287-55884309 TCTGGGCACTTCCTCAGCCTTGG + Intergenic
1032668206 7:134059102-134059124 CTTGGACAGTTCCCCAGTCAGGG + Intronic
1033721806 7:144067966-144067988 TCTGGGCAGATACCCAGTAATGG - Intergenic
1034504485 7:151476443-151476465 TCTCTCCAGTTCCACAGTCAAGG - Intronic
1035357467 7:158285190-158285212 TCTGGGCAGGAGCGCAGTGAAGG - Intronic
1036760493 8:11505582-11505604 ACTGGGCAGTTCCGCATCCTTGG + Intronic
1036923322 8:12879305-12879327 TCTGTGCATTTCCTCTGTCAGGG + Intergenic
1037522633 8:19694931-19694953 TCTGGGCCGTTTTGCAGACATGG - Intronic
1040484576 8:47857800-47857822 TCTGGGCAGCTCTGCAGACATGG - Intronic
1048043688 8:130753949-130753971 TCTGGGCAGCTCCTCTGTCCAGG + Intergenic
1048759817 8:137781777-137781799 GCTGGTCAATTCCACAGTCATGG - Intergenic
1050651878 9:7785405-7785427 TCTGGGCAGTTATGCAGGCCAGG + Intergenic
1057554016 9:96073098-96073120 TGGGGGCAGTCCCACAGTCAGGG - Intergenic
1057759466 9:97860801-97860823 TCAGGGCAGAGCCCCAGTCATGG + Intergenic
1059357401 9:113710565-113710587 TTTGGGCAGTTCAGCACCCAAGG + Intergenic
1060561188 9:124545021-124545043 TCTAGGAAGTTCCCCAGGCAGGG + Intronic
1060781170 9:126414398-126414420 TCCGGGCAGTTCCGTGGGCAGGG + Intronic
1060967056 9:127717278-127717300 CCTGGGCTGGTCCACAGTCAGGG + Intronic
1189294408 X:39908583-39908605 TCAGGGCAGTTCAGGAGTCATGG - Intergenic
1193709775 X:84865227-84865249 TCTGGGCATTTCCTCACTTATGG - Intergenic
1194165821 X:90514000-90514022 TCTGGGTAGATACCCAGTCATGG - Intergenic
1194271984 X:91826965-91826987 TCTGGGTAGTTACCCAGTAATGG + Intronic
1195108936 X:101625803-101625825 CCTGAGCAGTTCCCTAGTCATGG - Exonic
1195292450 X:103442186-103442208 GCTGGGCATTTCCTTAGTCAGGG + Intergenic
1200512093 Y:4091792-4091814 TCTGGGTAGATACCCAGTCATGG - Intergenic
1200589233 Y:5048403-5048425 TCTGGGTAGTTACCCAGTAATGG + Intronic