ID: 1001247809

View in Genome Browser
Species Human (GRCh38)
Location 5:170118080-170118102
Sequence GACCAAAGGCCTAGCTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001247809_1001247813 14 Left 1001247809 5:170118080-170118102 CCCTCACAGCTAGGCCTTTGGTC No data
Right 1001247813 5:170118117-170118139 AATTTCTCAGAGCATCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001247809 Original CRISPR GACCAAAGGCCTAGCTGTGA GGG (reversed) Intergenic
No off target data available for this crispr